ID: 1039374945

View in Genome Browser
Species Human (GRCh38)
Location 8:37023880-37023902
Sequence TCCCTAGACATAGTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039374945_1039374948 -9 Left 1039374945 8:37023880-37023902 CCTGGGGATACTATGTCTAGGGA No data
Right 1039374948 8:37023894-37023916 GTCTAGGGACATGTGGTGCAGGG No data
1039374945_1039374949 -8 Left 1039374945 8:37023880-37023902 CCTGGGGATACTATGTCTAGGGA No data
Right 1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG No data
1039374945_1039374950 8 Left 1039374945 8:37023880-37023902 CCTGGGGATACTATGTCTAGGGA No data
Right 1039374950 8:37023911-37023933 GCAGGGGAAAGTTGAATGATTGG No data
1039374945_1039374947 -10 Left 1039374945 8:37023880-37023902 CCTGGGGATACTATGTCTAGGGA No data
Right 1039374947 8:37023893-37023915 TGTCTAGGGACATGTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039374945 Original CRISPR TCCCTAGACATAGTATCCCC AGG (reversed) Intergenic
No off target data available for this crispr