ID: 1039374949

View in Genome Browser
Species Human (GRCh38)
Location 8:37023895-37023917
Sequence TCTAGGGACATGTGGTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039374943_1039374949 -7 Left 1039374943 8:37023879-37023901 CCCTGGGGATACTATGTCTAGGG No data
Right 1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG No data
1039374945_1039374949 -8 Left 1039374945 8:37023880-37023902 CCTGGGGATACTATGTCTAGGGA No data
Right 1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG No data
1039374937_1039374949 16 Left 1039374937 8:37023856-37023878 CCTTTCCTTGCTATCTCTGCTCT No data
Right 1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG No data
1039374938_1039374949 11 Left 1039374938 8:37023861-37023883 CCTTGCTATCTCTGCTCTCCCTG No data
Right 1039374949 8:37023895-37023917 TCTAGGGACATGTGGTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039374949 Original CRISPR TCTAGGGACATGTGGTGCAG GGG Intergenic
No off target data available for this crispr