ID: 1039374956

View in Genome Browser
Species Human (GRCh38)
Location 8:37023967-37023989
Sequence GACTTAGGCACCTGCTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039374956_1039374964 21 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374964 8:37024011-37024033 TGATGATACTGGTGTTCGGTGGG No data
1039374956_1039374966 23 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374966 8:37024013-37024035 ATGATACTGGTGTTCGGTGGGGG No data
1039374956_1039374967 26 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374967 8:37024016-37024038 ATACTGGTGTTCGGTGGGGGAGG No data
1039374956_1039374962 17 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG No data
1039374956_1039374965 22 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374965 8:37024012-37024034 GATGATACTGGTGTTCGGTGGGG No data
1039374956_1039374963 20 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374963 8:37024010-37024032 CTGATGATACTGGTGTTCGGTGG No data
1039374956_1039374968 30 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374968 8:37024020-37024042 TGGTGTTCGGTGGGGGAGGTCGG No data
1039374956_1039374960 10 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374960 8:37024000-37024022 CTGCTCTCCACTGATGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039374956 Original CRISPR GACTTAGGCACCTGCTAAAC AGG (reversed) Intergenic
No off target data available for this crispr