ID: 1039374959

View in Genome Browser
Species Human (GRCh38)
Location 8:37023989-37024011
Sequence AGTGGAGAGCAGCCTTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039374959_1039374967 4 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374967 8:37024016-37024038 ATACTGGTGTTCGGTGGGGGAGG No data
1039374959_1039374966 1 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374966 8:37024013-37024035 ATGATACTGGTGTTCGGTGGGGG No data
1039374959_1039374962 -5 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG No data
1039374959_1039374969 9 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374969 8:37024021-37024043 GGTGTTCGGTGGGGGAGGTCGGG No data
1039374959_1039374970 10 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374970 8:37024022-37024044 GTGTTCGGTGGGGGAGGTCGGGG No data
1039374959_1039374965 0 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374965 8:37024012-37024034 GATGATACTGGTGTTCGGTGGGG No data
1039374959_1039374968 8 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374968 8:37024020-37024042 TGGTGTTCGGTGGGGGAGGTCGG No data
1039374959_1039374963 -2 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374963 8:37024010-37024032 CTGATGATACTGGTGTTCGGTGG No data
1039374959_1039374964 -1 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374964 8:37024011-37024033 TGATGATACTGGTGTTCGGTGGG No data
1039374959_1039374971 28 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374971 8:37024040-37024062 CGGGGTTGTGAACCCAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039374959 Original CRISPR AGTGGAGAGCAGCCTTGCTG AGG (reversed) Intergenic
No off target data available for this crispr