ID: 1039374962

View in Genome Browser
Species Human (GRCh38)
Location 8:37024007-37024029
Sequence CCACTGATGATACTGGTGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039374958_1039374962 2 Left 1039374958 8:37023982-37024004 CCTAAGTCCTCAGCAAGGCTGCT No data
Right 1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG No data
1039374959_1039374962 -5 Left 1039374959 8:37023989-37024011 CCTCAGCAAGGCTGCTCTCCACT No data
Right 1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG No data
1039374956_1039374962 17 Left 1039374956 8:37023967-37023989 CCTGTTTAGCAGGTGCCTAAGTC No data
Right 1039374962 8:37024007-37024029 CCACTGATGATACTGGTGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039374962 Original CRISPR CCACTGATGATACTGGTGTT CGG Intergenic
No off target data available for this crispr