ID: 1039377648

View in Genome Browser
Species Human (GRCh38)
Location 8:37052257-37052279
Sequence TCCAATTTGGTGATGAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039377648_1039377652 -5 Left 1039377648 8:37052257-37052279 CCTTTATTCATCACCAAATTGGA No data
Right 1039377652 8:37052275-37052297 TTGGAAGAGGATTCCAGGAAAGG No data
1039377648_1039377651 -10 Left 1039377648 8:37052257-37052279 CCTTTATTCATCACCAAATTGGA No data
Right 1039377651 8:37052270-37052292 CCAAATTGGAAGAGGATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039377648 Original CRISPR TCCAATTTGGTGATGAATAA AGG (reversed) Intergenic
No off target data available for this crispr