ID: 1039379434

View in Genome Browser
Species Human (GRCh38)
Location 8:37071216-37071238
Sequence CTTTCTTTTGACTGAGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039379432_1039379434 0 Left 1039379432 8:37071193-37071215 CCAATGAGGAAGCTAGATGCAGA No data
Right 1039379434 8:37071216-37071238 CTTTCTTTTGACTGAGGCCCTGG No data
1039379429_1039379434 21 Left 1039379429 8:37071172-37071194 CCCTTTGATCATGACTGTCAGCC No data
Right 1039379434 8:37071216-37071238 CTTTCTTTTGACTGAGGCCCTGG No data
1039379430_1039379434 20 Left 1039379430 8:37071173-37071195 CCTTTGATCATGACTGTCAGCCA No data
Right 1039379434 8:37071216-37071238 CTTTCTTTTGACTGAGGCCCTGG No data
1039379428_1039379434 22 Left 1039379428 8:37071171-37071193 CCCCTTTGATCATGACTGTCAGC No data
Right 1039379434 8:37071216-37071238 CTTTCTTTTGACTGAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039379434 Original CRISPR CTTTCTTTTGACTGAGGCCC TGG Intergenic
No off target data available for this crispr