ID: 1039382822

View in Genome Browser
Species Human (GRCh38)
Location 8:37101695-37101717
Sequence CTATTGATGCAAGAAAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039382822_1039382828 7 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382828 8:37101725-37101747 AGACCTGTGCAGGGGAGTGCAGG No data
1039382822_1039382827 -1 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382827 8:37101717-37101739 GGTGGTAAAGACCTGTGCAGGGG No data
1039382822_1039382825 -3 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382825 8:37101715-37101737 TAGGTGGTAAAGACCTGTGCAGG No data
1039382822_1039382830 18 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG No data
1039382822_1039382826 -2 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382826 8:37101716-37101738 AGGTGGTAAAGACCTGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039382822 Original CRISPR CTATTGATGCAAGAAAGATT TGG (reversed) Intergenic
No off target data available for this crispr