ID: 1039382830

View in Genome Browser
Species Human (GRCh38)
Location 8:37101736-37101758
Sequence GGGGAGTGCAGGAGTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039382820_1039382830 20 Left 1039382820 8:37101693-37101715 CCCCAAATCTTTCTTGCATCAAT No data
Right 1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG No data
1039382821_1039382830 19 Left 1039382821 8:37101694-37101716 CCCAAATCTTTCTTGCATCAATA No data
Right 1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG No data
1039382819_1039382830 21 Left 1039382819 8:37101692-37101714 CCCCCAAATCTTTCTTGCATCAA No data
Right 1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG No data
1039382822_1039382830 18 Left 1039382822 8:37101695-37101717 CCAAATCTTTCTTGCATCAATAG No data
Right 1039382830 8:37101736-37101758 GGGGAGTGCAGGAGTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039382830 Original CRISPR GGGGAGTGCAGGAGTTTCAC AGG Intergenic
No off target data available for this crispr