ID: 1039384815

View in Genome Browser
Species Human (GRCh38)
Location 8:37125930-37125952
Sequence AGAATTCTGGACACCTACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039384815_1039384819 13 Left 1039384815 8:37125930-37125952 CCTCCGTAGGTGTCCAGAATTCT No data
Right 1039384819 8:37125966-37125988 TCTCTCCGCCATACTCTGCCTGG No data
1039384815_1039384822 23 Left 1039384815 8:37125930-37125952 CCTCCGTAGGTGTCCAGAATTCT No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039384815 Original CRISPR AGAATTCTGGACACCTACGG AGG (reversed) Intergenic
No off target data available for this crispr