ID: 1039384816

View in Genome Browser
Species Human (GRCh38)
Location 8:37125933-37125955
Sequence GAGAGAATTCTGGACACCTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039384816_1039384824 29 Left 1039384816 8:37125933-37125955 CCGTAGGTGTCCAGAATTCTCTC No data
Right 1039384824 8:37125985-37126007 CTGGCAAACTCTGGCTACCTTGG No data
1039384816_1039384819 10 Left 1039384816 8:37125933-37125955 CCGTAGGTGTCCAGAATTCTCTC No data
Right 1039384819 8:37125966-37125988 TCTCTCCGCCATACTCTGCCTGG No data
1039384816_1039384822 20 Left 1039384816 8:37125933-37125955 CCGTAGGTGTCCAGAATTCTCTC No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039384816 Original CRISPR GAGAGAATTCTGGACACCTA CGG (reversed) Intergenic
No off target data available for this crispr