ID: 1039384818

View in Genome Browser
Species Human (GRCh38)
Location 8:37125943-37125965
Sequence GCCACGCAGAGAGAGAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039384818_1039384822 10 Left 1039384818 8:37125943-37125965 CCAGAATTCTCTCTCTGCGTGGC No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data
1039384818_1039384824 19 Left 1039384818 8:37125943-37125965 CCAGAATTCTCTCTCTGCGTGGC No data
Right 1039384824 8:37125985-37126007 CTGGCAAACTCTGGCTACCTTGG No data
1039384818_1039384819 0 Left 1039384818 8:37125943-37125965 CCAGAATTCTCTCTCTGCGTGGC No data
Right 1039384819 8:37125966-37125988 TCTCTCCGCCATACTCTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039384818 Original CRISPR GCCACGCAGAGAGAGAATTC TGG (reversed) Intergenic
No off target data available for this crispr