ID: 1039384822

View in Genome Browser
Species Human (GRCh38)
Location 8:37125976-37125998
Sequence ATACTCTGCCTGGCAAACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039384815_1039384822 23 Left 1039384815 8:37125930-37125952 CCTCCGTAGGTGTCCAGAATTCT No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data
1039384818_1039384822 10 Left 1039384818 8:37125943-37125965 CCAGAATTCTCTCTCTGCGTGGC No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data
1039384816_1039384822 20 Left 1039384816 8:37125933-37125955 CCGTAGGTGTCCAGAATTCTCTC No data
Right 1039384822 8:37125976-37125998 ATACTCTGCCTGGCAAACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039384822 Original CRISPR ATACTCTGCCTGGCAAACTC TGG Intergenic
No off target data available for this crispr