ID: 1039387923

View in Genome Browser
Species Human (GRCh38)
Location 8:37152857-37152879
Sequence AGTAGCTAAAAGTCTTAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039387919_1039387923 10 Left 1039387919 8:37152824-37152846 CCTCTGGGTTTACTGTTGGGCTT No data
Right 1039387923 8:37152857-37152879 AGTAGCTAAAAGTCTTAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039387923 Original CRISPR AGTAGCTAAAAGTCTTAGGT AGG Intergenic
No off target data available for this crispr