ID: 1039388229 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:37155625-37155647 |
| Sequence | TTTTACTGCATGGTGACGTT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1039388229_1039388231 | 3 | Left | 1039388229 | 8:37155625-37155647 | CCTAACGTCACCATGCAGTAAAA | No data | ||
| Right | 1039388231 | 8:37155651-37155673 | CTGTCCCATTAATGATGTTGAGG | No data | ||||
| 1039388229_1039388234 | 10 | Left | 1039388229 | 8:37155625-37155647 | CCTAACGTCACCATGCAGTAAAA | No data | ||
| Right | 1039388234 | 8:37155658-37155680 | ATTAATGATGTTGAGGCAGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1039388229 | Original CRISPR | TTTTACTGCATGGTGACGTT AGG (reversed) | Intergenic | ||