ID: 1039388229

View in Genome Browser
Species Human (GRCh38)
Location 8:37155625-37155647
Sequence TTTTACTGCATGGTGACGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039388229_1039388231 3 Left 1039388229 8:37155625-37155647 CCTAACGTCACCATGCAGTAAAA No data
Right 1039388231 8:37155651-37155673 CTGTCCCATTAATGATGTTGAGG No data
1039388229_1039388234 10 Left 1039388229 8:37155625-37155647 CCTAACGTCACCATGCAGTAAAA No data
Right 1039388234 8:37155658-37155680 ATTAATGATGTTGAGGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039388229 Original CRISPR TTTTACTGCATGGTGACGTT AGG (reversed) Intergenic