ID: 1039388231

View in Genome Browser
Species Human (GRCh38)
Location 8:37155651-37155673
Sequence CTGTCCCATTAATGATGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039388228_1039388231 14 Left 1039388228 8:37155614-37155636 CCTGAAAACATCCTAACGTCACC No data
Right 1039388231 8:37155651-37155673 CTGTCCCATTAATGATGTTGAGG No data
1039388227_1039388231 26 Left 1039388227 8:37155602-37155624 CCTACAAGAGGTCCTGAAAACAT No data
Right 1039388231 8:37155651-37155673 CTGTCCCATTAATGATGTTGAGG No data
1039388230_1039388231 -7 Left 1039388230 8:37155635-37155657 CCATGCAGTAAAACAACTGTCCC No data
Right 1039388231 8:37155651-37155673 CTGTCCCATTAATGATGTTGAGG No data
1039388229_1039388231 3 Left 1039388229 8:37155625-37155647 CCTAACGTCACCATGCAGTAAAA No data
Right 1039388231 8:37155651-37155673 CTGTCCCATTAATGATGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039388231 Original CRISPR CTGTCCCATTAATGATGTTG AGG Intergenic