ID: 1039393883

View in Genome Browser
Species Human (GRCh38)
Location 8:37206336-37206358
Sequence TAAGGAGACGATTCTTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039393883_1039393887 -10 Left 1039393883 8:37206336-37206358 CCCTTTCAAGAATCGTCTCCTTA No data
Right 1039393887 8:37206349-37206371 CGTCTCCTTAGAAGGTGAAAGGG No data
1039393883_1039393889 8 Left 1039393883 8:37206336-37206358 CCCTTTCAAGAATCGTCTCCTTA No data
Right 1039393889 8:37206367-37206389 AAGGGCATGAAGAGAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039393883 Original CRISPR TAAGGAGACGATTCTTGAAA GGG (reversed) Intergenic
No off target data available for this crispr