ID: 1039393886

View in Genome Browser
Species Human (GRCh38)
Location 8:37206348-37206370
Sequence TCGTCTCCTTAGAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039393882_1039393886 -8 Left 1039393882 8:37206333-37206355 CCACCCTTTCAAGAATCGTCTCC No data
Right 1039393886 8:37206348-37206370 TCGTCTCCTTAGAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039393886 Original CRISPR TCGTCTCCTTAGAAGGTGAA AGG Intergenic
No off target data available for this crispr