ID: 1039393887

View in Genome Browser
Species Human (GRCh38)
Location 8:37206349-37206371
Sequence CGTCTCCTTAGAAGGTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039393883_1039393887 -10 Left 1039393883 8:37206336-37206358 CCCTTTCAAGAATCGTCTCCTTA No data
Right 1039393887 8:37206349-37206371 CGTCTCCTTAGAAGGTGAAAGGG No data
1039393882_1039393887 -7 Left 1039393882 8:37206333-37206355 CCACCCTTTCAAGAATCGTCTCC No data
Right 1039393887 8:37206349-37206371 CGTCTCCTTAGAAGGTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039393887 Original CRISPR CGTCTCCTTAGAAGGTGAAA GGG Intergenic
No off target data available for this crispr