ID: 1039393889

View in Genome Browser
Species Human (GRCh38)
Location 8:37206367-37206389
Sequence AAGGGCATGAAGAGAAGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039393884_1039393889 7 Left 1039393884 8:37206337-37206359 CCTTTCAAGAATCGTCTCCTTAG No data
Right 1039393889 8:37206367-37206389 AAGGGCATGAAGAGAAGCTGAGG No data
1039393883_1039393889 8 Left 1039393883 8:37206336-37206358 CCCTTTCAAGAATCGTCTCCTTA No data
Right 1039393889 8:37206367-37206389 AAGGGCATGAAGAGAAGCTGAGG No data
1039393888_1039393889 -10 Left 1039393888 8:37206354-37206376 CCTTAGAAGGTGAAAGGGCATGA No data
Right 1039393889 8:37206367-37206389 AAGGGCATGAAGAGAAGCTGAGG No data
1039393882_1039393889 11 Left 1039393882 8:37206333-37206355 CCACCCTTTCAAGAATCGTCTCC No data
Right 1039393889 8:37206367-37206389 AAGGGCATGAAGAGAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039393889 Original CRISPR AAGGGCATGAAGAGAAGCTG AGG Intergenic
No off target data available for this crispr