ID: 1039398634

View in Genome Browser
Species Human (GRCh38)
Location 8:37248440-37248462
Sequence TGTCCCTCCTTGACTGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039398630_1039398634 19 Left 1039398630 8:37248398-37248420 CCAAAGCTAGTAATAAGACACAC No data
Right 1039398634 8:37248440-37248462 TGTCCCTCCTTGACTGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039398634 Original CRISPR TGTCCCTCCTTGACTGAGGG AGG Intergenic
No off target data available for this crispr