ID: 1039407712

View in Genome Browser
Species Human (GRCh38)
Location 8:37327230-37327252
Sequence AGTTGTAAACAGATGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039407712_1039407716 6 Left 1039407712 8:37327230-37327252 CCTTGTTCCATCTGTTTACAACT No data
Right 1039407716 8:37327259-37327281 CCTCTGAAAGTTGAGATATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039407712 Original CRISPR AGTTGTAAACAGATGGAACA AGG (reversed) Intergenic
No off target data available for this crispr