ID: 1039408329

View in Genome Browser
Species Human (GRCh38)
Location 8:37331374-37331396
Sequence CGGGGGAGACTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039408313_1039408329 27 Left 1039408313 8:37331324-37331346 CCTCTCTTAGGAGAAGGCTGGGC No data
Right 1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG No data
1039408311_1039408329 28 Left 1039408311 8:37331323-37331345 CCCTCTCTTAGGAGAAGGCTGGG No data
Right 1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG No data
1039408309_1039408329 29 Left 1039408309 8:37331322-37331344 CCCCTCTCTTAGGAGAAGGCTGG No data
Right 1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039408329 Original CRISPR CGGGGGAGACTGAAGGAGGA GGG Intergenic
No off target data available for this crispr