ID: 1039409853

View in Genome Browser
Species Human (GRCh38)
Location 8:37343623-37343645
Sequence CAATTCCTACTCATTTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039409853_1039409855 -2 Left 1039409853 8:37343623-37343645 CCAGTGAAAATGAGTAGGAATTG No data
Right 1039409855 8:37343644-37343666 TGTGTGTCACTTCTAGGCAAAGG No data
1039409853_1039409854 -8 Left 1039409853 8:37343623-37343645 CCAGTGAAAATGAGTAGGAATTG No data
Right 1039409854 8:37343638-37343660 AGGAATTGTGTGTCACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039409853 Original CRISPR CAATTCCTACTCATTTTCAC TGG (reversed) Intergenic
No off target data available for this crispr