ID: 1039412341

View in Genome Browser
Species Human (GRCh38)
Location 8:37365512-37365534
Sequence ACAGCTCCTGCTCTAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039412341_1039412344 -7 Left 1039412341 8:37365512-37365534 CCAGGGCCTAGAGCAGGAGCTGT No data
Right 1039412344 8:37365528-37365550 GAGCTGTGCCCTTCTGTGAAGGG No data
1039412341_1039412343 -8 Left 1039412341 8:37365512-37365534 CCAGGGCCTAGAGCAGGAGCTGT No data
Right 1039412343 8:37365527-37365549 GGAGCTGTGCCCTTCTGTGAAGG No data
1039412341_1039412347 21 Left 1039412341 8:37365512-37365534 CCAGGGCCTAGAGCAGGAGCTGT No data
Right 1039412347 8:37365556-37365578 AAACAGAGCAGCCACCATGATGG No data
1039412341_1039412348 28 Left 1039412341 8:37365512-37365534 CCAGGGCCTAGAGCAGGAGCTGT No data
Right 1039412348 8:37365563-37365585 GCAGCCACCATGATGGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039412341 Original CRISPR ACAGCTCCTGCTCTAGGCCC TGG (reversed) Intergenic
No off target data available for this crispr