ID: 1039413517

View in Genome Browser
Species Human (GRCh38)
Location 8:37375134-37375156
Sequence CTGGCGGCTCTGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039413517_1039413520 -10 Left 1039413517 8:37375134-37375156 CCTTCACATTTCAGAGCCGCCAG No data
Right 1039413520 8:37375147-37375169 GAGCCGCCAGCCTGGGTCACAGG No data
1039413517_1039413521 -9 Left 1039413517 8:37375134-37375156 CCTTCACATTTCAGAGCCGCCAG No data
Right 1039413521 8:37375148-37375170 AGCCGCCAGCCTGGGTCACAGGG No data
1039413517_1039413522 -8 Left 1039413517 8:37375134-37375156 CCTTCACATTTCAGAGCCGCCAG No data
Right 1039413522 8:37375149-37375171 GCCGCCAGCCTGGGTCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039413517 Original CRISPR CTGGCGGCTCTGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr