ID: 1039417646

View in Genome Browser
Species Human (GRCh38)
Location 8:37409401-37409423
Sequence CCTCATATTAACCATCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039417646_1039417650 -1 Left 1039417646 8:37409401-37409423 CCTCCATGATGGTTAATATGAGG No data
Right 1039417650 8:37409423-37409445 GTGCTGGCTTAACTGAATTGAGG No data
1039417646_1039417651 0 Left 1039417646 8:37409401-37409423 CCTCCATGATGGTTAATATGAGG No data
Right 1039417651 8:37409424-37409446 TGCTGGCTTAACTGAATTGAGGG No data
1039417646_1039417654 21 Left 1039417646 8:37409401-37409423 CCTCCATGATGGTTAATATGAGG No data
Right 1039417654 8:37409445-37409467 GGATGCCTAGATGGCCGGTGAGG No data
1039417646_1039417653 16 Left 1039417646 8:37409401-37409423 CCTCCATGATGGTTAATATGAGG No data
Right 1039417653 8:37409440-37409462 TTGAGGGATGCCTAGATGGCCGG No data
1039417646_1039417652 12 Left 1039417646 8:37409401-37409423 CCTCCATGATGGTTAATATGAGG No data
Right 1039417652 8:37409436-37409458 TGAATTGAGGGATGCCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039417646 Original CRISPR CCTCATATTAACCATCATGG AGG (reversed) Intergenic
No off target data available for this crispr