ID: 1039422015

View in Genome Browser
Species Human (GRCh38)
Location 8:37451091-37451113
Sequence TGTCTCTGCATCACAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039422015_1039422019 12 Left 1039422015 8:37451091-37451113 CCTCCCACTGTGATGCAGAGACA No data
Right 1039422019 8:37451126-37451148 TGCAGCCCACAGCCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039422015 Original CRISPR TGTCTCTGCATCACAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr