ID: 1039426882

View in Genome Browser
Species Human (GRCh38)
Location 8:37493521-37493543
Sequence CAGACTCCAGGAGAAGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039426875_1039426882 0 Left 1039426875 8:37493498-37493520 CCCACAGGTCCCATTCTGTCACA 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426876_1039426882 -1 Left 1039426876 8:37493499-37493521 CCACAGGTCCCATTCTGTCACAC 0: 1
1: 0
2: 3
3: 14
4: 203
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426878_1039426882 -10 Left 1039426878 8:37493508-37493530 CCATTCTGTCACACAGACTCCAG 0: 1
1: 0
2: 2
3: 35
4: 458
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426877_1039426882 -9 Left 1039426877 8:37493507-37493529 CCCATTCTGTCACACAGACTCCA 0: 1
1: 0
2: 3
3: 25
4: 321
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039426882 Original CRISPR CAGACTCCAGGAGAAGGCGG CGG Intergenic