ID: 1039426882

View in Genome Browser
Species Human (GRCh38)
Location 8:37493521-37493543
Sequence CAGACTCCAGGAGAAGGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 295}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039426877_1039426882 -9 Left 1039426877 8:37493507-37493529 CCCATTCTGTCACACAGACTCCA 0: 1
1: 0
2: 3
3: 25
4: 321
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426878_1039426882 -10 Left 1039426878 8:37493508-37493530 CCATTCTGTCACACAGACTCCAG 0: 1
1: 0
2: 2
3: 35
4: 458
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426875_1039426882 0 Left 1039426875 8:37493498-37493520 CCCACAGGTCCCATTCTGTCACA 0: 1
1: 0
2: 2
3: 9
4: 156
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295
1039426876_1039426882 -1 Left 1039426876 8:37493499-37493521 CCACAGGTCCCATTCTGTCACAC 0: 1
1: 0
2: 3
3: 14
4: 203
Right 1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG 0: 1
1: 0
2: 2
3: 35
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039426882 Original CRISPR CAGACTCCAGGAGAAGGCGG CGG Intergenic
900512160 1:3065883-3065905 CAGACCCCAGCAGAAGTTGGTGG + Intergenic
900933395 1:5750727-5750749 CAGTCTCCAGGGGCAGGTGGGGG - Intergenic
901183314 1:7356559-7356581 GAGACTGGAGGAGGAGGCGGTGG - Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901483255 1:9540094-9540116 GAGGCCCCAGGAGAAGGGGGCGG - Intronic
902030181 1:13416537-13416559 GAGACCCCAGAGGAAGGCGGAGG - Exonic
902656989 1:17875940-17875962 CAGGCTCCAGGAGCTGCCGGAGG + Intergenic
902975510 1:20085401-20085423 GAGACTCCAGGAGGAGCTGGAGG + Intronic
904962484 1:34345209-34345231 GAGATGCCAGGAGAAGACGGAGG - Intergenic
905273490 1:36802119-36802141 CAGACTCTGGGAGAAAGGGGAGG - Intronic
906284896 1:44580839-44580861 CAGTCTCCTGGAGAAGCTGGAGG - Intronic
906460418 1:46031999-46032021 CAGACCCCAAGAGACGGTGGTGG - Intronic
907447356 1:54517138-54517160 CAGGCTGCAGGAGCAGGCGGAGG - Intergenic
907744705 1:57201399-57201421 CAGACACCGAGAGAAGGCTGGGG - Intronic
912386796 1:109274775-109274797 CAGAGTCCAGGAAAAGGAGAGGG - Exonic
915083174 1:153365989-153366011 CAGACTCCAAGTCAAGGCGGGGG - Intergenic
915168917 1:153964128-153964150 CACCCACCTGGAGAAGGCGGAGG - Intronic
915227112 1:154419421-154419443 AAGCCTCCAGGAGAAGCCTGTGG - Intronic
916082199 1:161241123-161241145 CAGACTACAGGAGAAGGACAAGG + Intergenic
916162860 1:161936849-161936871 AAGACTACAGGAGAAGGTTGAGG - Intronic
916926654 1:169528302-169528324 CAGCCTACAGCAGAAGGCAGGGG + Intronic
918282856 1:183023241-183023263 GCGACTCCAGGAGGCGGCGGGGG - Intergenic
918517108 1:185375477-185375499 TAGACTGCACGAGAAGGAGGTGG - Intergenic
918981212 1:191561480-191561502 CTGACTCCAGGAGCAGGCGGAGG + Intergenic
920495866 1:206454536-206454558 CGGCCTCCTGGAGAAGGAGGCGG - Intronic
921138833 1:212286029-212286051 GAGACGGCAGGAGGAGGCGGGGG - Exonic
921944901 1:220879764-220879786 GCGAGTCCCGGAGAAGGCGGCGG - Exonic
922110006 1:222547470-222547492 CAGGCTCCAGGAGAATGAGAGGG - Intronic
922934683 1:229413675-229413697 CAGACTAAGGGAGAAGGAGGAGG - Intergenic
924329121 1:242924806-242924828 CAGACTCCAGGAGGCGGAGGTGG - Intergenic
924864468 1:247962382-247962404 TTGACTCCAGGAGAAGGAGAAGG + Intronic
1062980778 10:1720693-1720715 CACACTGCAGGAGCATGCGGGGG + Intronic
1063662756 10:8045288-8045310 CAGTGAGCAGGAGAAGGCGGAGG + Intergenic
1063777080 10:9275374-9275396 CTGATTTCAGGAGAAGGTGGTGG - Intergenic
1063821595 10:9842634-9842656 CTGAGTCCAGGAGAAGGTGAAGG - Intergenic
1064008611 10:11717292-11717314 CACACTCCAGGAGAAAGCAGAGG - Intergenic
1068584635 10:58783186-58783208 CAGCCACCAGGAGAGGGTGGGGG + Intronic
1070096299 10:73340795-73340817 CAGGCACCAGGAGTAGGCAGAGG + Intronic
1070787424 10:79170088-79170110 CAGACTCCAGGAGAGGGGCCTGG - Intronic
1070789819 10:79182347-79182369 CCACCTCCAGGAGAAGGTGGGGG + Intronic
1070827056 10:79397467-79397489 CAGACCCCAGGTGAAGGAGAAGG - Intronic
1072414001 10:95231700-95231722 CAGTCTGCAGGAAAAGGCGCAGG - Intergenic
1073151859 10:101317153-101317175 CAGTCACCAGGAGAAGGCCAGGG - Intergenic
1074208549 10:111305869-111305891 CAGAGCTCAGGAGAAGGTGGTGG - Intergenic
1074308363 10:112299687-112299709 AAGACTCCAGGAGCAGGTGAAGG - Intronic
1074790922 10:116887101-116887123 CAGACTTCAGGAGGGGGTGGTGG + Intronic
1075253554 10:120905637-120905659 CAGACTCTGGGAGAAAGAGGAGG - Intronic
1077222927 11:1425396-1425418 CAGAGTCCAGGAGGAAGCTGTGG + Intronic
1077245521 11:1535429-1535451 CAGACTGCAGGTGAATGGGGAGG - Intergenic
1077265197 11:1645167-1645189 AAGCCTCCAGCAGAAGCCGGAGG - Intergenic
1077281962 11:1749857-1749879 CAGACTCCAGGAAAGGGGGCAGG - Intronic
1077548845 11:3190382-3190404 CAGACTCCAAGAGCCGACGGTGG - Intergenic
1077554207 11:3218154-3218176 CAGGCTCCAGTAGAAGACCGAGG + Exonic
1078327761 11:10394297-10394319 GAGAGTCCAGGAGAAGGGGTGGG - Intronic
1079185498 11:18232286-18232308 CAGACCCCAGGAGTATGTGGAGG + Intronic
1080776552 11:35392429-35392451 AAGTCACCAGGAGTAGGCGGAGG + Intronic
1081646067 11:44791548-44791570 CAGTGCCCAGGAGAAGGAGGCGG - Intronic
1081776517 11:45679252-45679274 CAGACTCTAGCAGGAGGCGGTGG + Intergenic
1083603311 11:63962024-63962046 CAAACTCCAGGAGAAGATGGAGG - Intergenic
1084898796 11:72294506-72294528 CAGACACCAGGGGAAGACTGGGG + Intronic
1085380336 11:76111291-76111313 CAGACTCCAGAAGGATGTGGTGG + Intronic
1085392397 11:76189174-76189196 GAGCCTTCAGGAGAAGGCTGAGG - Intronic
1085392706 11:76190509-76190531 CTGTCTCCAGGAGAGGGAGGGGG - Intronic
1086322340 11:85664292-85664314 AAGTCCCCAGGAGGAGGCGGCGG - Exonic
1089056007 11:115585401-115585423 CTGTGTCCAGGAGGAGGCGGAGG + Intergenic
1090095824 11:123741258-123741280 CAGGCCCCAGGAGGGGGCGGAGG + Intronic
1090360912 11:126171994-126172016 CTGCCTCCAGGAGGAGGTGGAGG - Intergenic
1090400410 11:126445125-126445147 CAGATGCCAAGAGCAGGCGGAGG + Intronic
1091766020 12:3120421-3120443 CAGGCTCCAGGGGAAGGCTGTGG - Intronic
1091872727 12:3908426-3908448 CAGGCGCCAGGAGAAGACTGTGG - Intergenic
1092048916 12:5454186-5454208 CAGAGGCTAGGAGAAGGCGTGGG - Intronic
1092998497 12:13973563-13973585 CAGGGTCCCTGAGAAGGCGGTGG - Intronic
1095969482 12:47891933-47891955 CAGAACTCAGGAGAAGGCTGAGG + Intronic
1096790137 12:54039340-54039362 CAGACTCTGGGAGAAGGAAGGGG + Intronic
1100550768 12:95644478-95644500 GAGACTCCAGAAGGAGGAGGAGG - Intergenic
1101836956 12:108302614-108302636 CACACTCCAGGACAGGGCGGAGG - Intronic
1102540847 12:113618054-113618076 CAGACTCCAGGAGACAGCAATGG + Intergenic
1103529732 12:121592590-121592612 CAGATTCCAGGAGAAACAGGAGG - Intergenic
1103721156 12:122976283-122976305 CTGACTCCAGGGGAAGGAGGAGG - Exonic
1105991550 13:25627128-25627150 GAGACTCCAGGAGAATGAGATGG + Intronic
1107883579 13:44855270-44855292 CAGGCTCCAGGACAAGGCCCAGG + Intergenic
1108478541 13:50843820-50843842 CGGACTTCAGGCGAAGGCAGAGG - Exonic
1109478760 13:62919743-62919765 CAGACACCAGGAGCAGGGAGAGG + Intergenic
1109741390 13:66560294-66560316 CAGACTGCATGGGAAGGGGGAGG + Intronic
1111912383 13:94327172-94327194 CAGGCTCCAGCAGAAGGCAGTGG - Intronic
1112507144 13:99981952-99981974 CGGGCTCCAGGCGCAGGCGGCGG - Exonic
1113585652 13:111462420-111462442 CAGACTCCAGGTGTGGACGGAGG + Intergenic
1113901921 13:113802355-113802377 CAGGCGCCAGGAGAGGGCAGAGG - Intronic
1114051473 14:18922018-18922040 CAGATTGCAGGAGAAGGGGAAGG - Intergenic
1114111088 14:19479906-19479928 CAGATTGCAGGAGAAGGGGAAGG + Intergenic
1114516392 14:23302459-23302481 CAGCCTCGAGGAGGAGCCGGAGG - Exonic
1115329742 14:32183595-32183617 CAGACTCCAGTAAAAGTGGGAGG + Intergenic
1115892307 14:38045045-38045067 CAGAGTCCAGCAGAAGGTGATGG + Intergenic
1117531641 14:56665659-56665681 GAGAGTCCTTGAGAAGGCGGTGG - Intronic
1118236388 14:64008857-64008879 CAGCCTCTAGGAGAAAGCTGGGG - Intronic
1120843693 14:89108301-89108323 CAAACTCCAGTGGAAGGCAGAGG - Intergenic
1122068109 14:99187780-99187802 CTGTCTCCAGGAGGAGGAGGAGG - Intronic
1122422531 14:101586694-101586716 CAGCCTCCAGGAGAACTTGGTGG + Intergenic
1202867951 14_GL000225v1_random:135429-135451 CATTTTCCAGGGGAAGGCGGTGG + Intergenic
1123418235 15:20108029-20108051 CAGAACCCAGGAGAATGGGGAGG + Intergenic
1123527453 15:21114551-21114573 CAGAACCCAGGAGAATGGGGAGG + Intergenic
1124422737 15:29536893-29536915 CAGAAGCCAGGAGAAAGGGGAGG + Intronic
1124665277 15:31586871-31586893 CAGAGGCCAGGAGGAGGAGGAGG - Intronic
1125972303 15:43921780-43921802 CAGAGGCCAAGAGAAGGTGGAGG + Intronic
1126950305 15:53873356-53873378 CATACTCCAGGAGCAAGCTGCGG - Intergenic
1128115518 15:65102486-65102508 CGGACACCAGGAGAGGCCGGAGG - Exonic
1128147537 15:65340273-65340295 CAGGCTCCAGGGGGAGGTGGGGG + Intronic
1129109797 15:73330694-73330716 CAGCCCCCAGGGGAAGGCGCAGG + Intronic
1129317126 15:74751780-74751802 GAGGCTCCAGGAGATGGCTGTGG - Exonic
1132330151 15:101007095-101007117 CAAACTCCTGGAGTGGGCGGAGG + Intronic
1132931507 16:2461207-2461229 CACACTCAAGGAGAAGGGGTAGG + Exonic
1132981208 16:2739506-2739528 CAGACACAAGGAGAAGGGGCTGG - Intergenic
1133240581 16:4412015-4412037 GGGACTCCAGCAGAAGACGGAGG + Intronic
1133823527 16:9257773-9257795 CAGATTCCAGGAGATGGATGAGG - Intergenic
1134637549 16:15803809-15803831 CGGGCTCCAGGAGAAGGCCTGGG + Intronic
1135508233 16:23058334-23058356 CAGGGTCCAGGAGCAGGCTGCGG - Intergenic
1135591703 16:23709925-23709947 CAGAGTCCTGGAGAAGGCCCTGG + Intronic
1135892624 16:26371369-26371391 CAGACTCCAGGAGAAAGATGAGG + Intergenic
1136281279 16:29212957-29212979 CAGCCTCCAGGTGAAGGTGGTGG - Intergenic
1136605774 16:31332298-31332320 GAGACTCCATGAGAAGCCGTGGG + Exonic
1137763963 16:50963298-50963320 CAGGCTCCAGGACAAGGCAGGGG - Intergenic
1140239020 16:73184365-73184387 CAGTTTTCAGGAGAAGGCAGTGG + Intergenic
1140665063 16:77219862-77219884 AATAATCCAGGAGAAGGCAGAGG + Intergenic
1140699985 16:77572735-77572757 AAGACTGCAGGAGATGGAGGAGG + Intergenic
1141679637 16:85536685-85536707 CAGGCTCCTGGAGAGGGCAGGGG - Intergenic
1142085648 16:88178885-88178907 CGGCCTCCAGGTGAAGGTGGTGG - Intergenic
1142120691 16:88385215-88385237 AAGACTCCAGGAGAAAGGAGGGG - Intergenic
1142248965 16:88982533-88982555 CTGACTCCAGGGGGCGGCGGTGG - Intergenic
1145298811 17:21614772-21614794 GAGATTGCAGGAGAAGGGGGAGG - Intergenic
1145403630 17:22568320-22568342 GAGACTGCAGGAGAAGGGGGAGG + Intergenic
1145723290 17:27091510-27091532 GAGACTGCAGGAAAAGGGGGAGG - Intergenic
1147428579 17:40357668-40357690 CAGACGCCAAGAGGAGGGGGTGG - Intergenic
1147548693 17:41422738-41422760 CAGACTCCTGGGGAGGGCGCTGG - Intronic
1147772872 17:42879679-42879701 CAGGCTCCACCAGAAGGCGGGGG - Intergenic
1147907351 17:43831938-43831960 CAGATTCTGGGAGAAGGGGGTGG + Exonic
1149755598 17:59182908-59182930 CAGAGTCCAGAAGAAGGCCTTGG - Intronic
1151350946 17:73531905-73531927 CAGTGTCCAGGAGAAGCTGGTGG - Intronic
1151763325 17:76119745-76119767 CTAACTCCAGGAGGAGGAGGAGG + Intronic
1151763424 17:76120337-76120359 CAGGTTCCAGGAGAAGGCTGTGG + Intronic
1152811875 17:82386190-82386212 TAGAGGCCAGGGGAAGGCGGAGG - Intergenic
1152811934 17:82386400-82386422 TAGAGGCCAGGGGAAGGCGGAGG - Intergenic
1152811948 17:82386451-82386473 TAGAGGCCAGGGGAAGGCGGAGG - Intergenic
1153004956 18:490001-490023 CAGATTCCAGGGGAAGGAAGTGG - Intronic
1154170207 18:12046076-12046098 GAGACTGCAGGAGAACGGGGAGG + Intergenic
1154172615 18:12062163-12062185 GAGACTGCAGGAGAAGGGGGAGG - Intergenic
1154191200 18:12232140-12232162 CAGAGTCCAGGGGCAGGAGGCGG + Intergenic
1154485448 18:14868311-14868333 GAGACTGCAGGAGAAGGGGGAGG - Intergenic
1161038413 19:2097717-2097739 CAAACTTCAGGGGAGGGCGGTGG - Intronic
1161435221 19:4258883-4258905 CAGACTCCAGAGGAAAGCAGGGG + Intronic
1161661582 19:5549781-5549803 CAGGCTAAAGGAGAAGGAGGAGG - Intergenic
1161731740 19:5964882-5964904 CAGACCCCAGGGAAGGGCGGAGG - Intronic
1162039334 19:7960328-7960350 CACCTTCCAGGAGAAGGTGGCGG + Exonic
1163138893 19:15332837-15332859 CAGACTGATGGAGGAGGCGGAGG + Intergenic
1163267865 19:16232557-16232579 CAGACTCCAGGAGGATGACGGGG - Intronic
1163424282 19:17232570-17232592 GAGCCTGCAGGAGAAGGCGCAGG - Exonic
1164155751 19:22596050-22596072 CTGACTCCGGGAGCGGGCGGGGG - Intergenic
1164390123 19:27812785-27812807 CAGGCTCCAGGACAATGTGGGGG + Intergenic
1164594571 19:29525159-29525181 CAGACTCCGGGTGAAGGCTGGGG + Intergenic
1165242259 19:34478207-34478229 CACAGTCCAGGAGAAGGATGGGG - Intergenic
1165311137 19:35030210-35030232 CAGACTCCCTGGGAAGGTGGGGG + Intergenic
1166051518 19:40263583-40263605 CAGACTCCAGGCTCAGGCTGGGG + Intronic
1166938507 19:46349414-46349436 CAAAACCCTGGAGAAGGCGGAGG + Intronic
1167001162 19:46746374-46746396 CGGACGGCAGGAGGAGGCGGCGG + Exonic
1167589944 19:50398995-50399017 CAGGCTGCAGGAGCAGGAGGAGG + Exonic
1167598623 19:50440716-50440738 AAGACCCCAGGAGGAGGCTGGGG + Intronic
1167685449 19:50953024-50953046 CAGAGCCCAGGAGGAGGCAGTGG - Exonic
925020276 2:563036-563058 CAGACACCAGGAGAATGGTGGGG - Intergenic
925194606 2:1912998-1913020 CAAACTCCAGGGGAATGGGGTGG + Intronic
925976725 2:9146882-9146904 GAGGCTGCAGGGGAAGGCGGGGG - Intergenic
926123283 2:10256267-10256289 CAGACACCAGGAGAAGCCAGGGG + Intergenic
927676240 2:25108201-25108223 GAAACACCAGGAGAAGGTGGGGG + Intronic
934915875 2:98300641-98300663 AAGACACCAGGAGGAGGCAGAGG - Intronic
935386150 2:102501860-102501882 CAGAGTCAAGCAGAAGGCGTGGG + Intronic
935414926 2:102805291-102805313 CAGACTCAAGGAGCAGGCTTTGG - Intronic
936013549 2:108941425-108941447 CAGTCACCAGGGCAAGGCGGAGG + Intronic
936093499 2:109515436-109515458 CAGACTCCAGGACAAAGCCCTGG + Intergenic
936111914 2:109671538-109671560 GATTCTCCAGGAGAAGGGGGAGG - Intergenic
936487839 2:112942059-112942081 CAGGACCCAGGAGAAGGCAGGGG + Intergenic
937447989 2:121975051-121975073 GAGACACCAGGAGAGGCCGGGGG - Intergenic
941508336 2:166375744-166375766 CTGGCTCCAGGAGAGGGCGCGGG + Exonic
944901898 2:204223845-204223867 CAGCCTCCAGGAGCAGGGAGAGG + Intergenic
945241359 2:207679824-207679846 TAGACTGGAGGAGAAGGAGGAGG + Intergenic
947592369 2:231393105-231393127 CAGATACCAGGAGAAGAGGGTGG - Intergenic
947761026 2:232604149-232604171 GAGGCTCCAGGAGAGAGCGGTGG - Intergenic
1169367095 20:5001022-5001044 CAGAGCCCGGGAGGAGGCGGCGG + Intronic
1170677591 20:18496915-18496937 CAGACTTTAAGAGAAGGCAGCGG + Intronic
1172281446 20:33710734-33710756 CAGCCTCCAGGAGAAGCTGTGGG - Exonic
1172300560 20:33846741-33846763 CAGTCTGCAGGAGATGGCTGTGG + Intronic
1173966350 20:47115636-47115658 CAGACCCGTGGAGAGGGCGGAGG - Intronic
1174078149 20:47952548-47952570 GTGAGTCCAGGAGAAGGGGGAGG - Intergenic
1175158178 20:56988334-56988356 CCGCCTTTAGGAGAAGGCGGAGG - Intergenic
1175377422 20:58538322-58538344 CAGATTCCAGGACAAGGAGAAGG - Intergenic
1175691287 20:61067664-61067686 CAGACTCCAGGAGACCAGGGTGG - Intergenic
1175846763 20:62063915-62063937 CAGTCTCCAGGCGAGGACGGGGG - Intronic
1175977182 20:62716927-62716949 CAAACTCCAGGGCATGGCGGGGG - Intronic
1176021329 20:62963778-62963800 CAGAGTCCAGGAGGAGCCGAGGG - Intronic
1176082831 20:63282506-63282528 CAGACTTCAGGACAGGGCCGGGG - Intronic
1176244108 20:64089268-64089290 CAGGGTCCAGCAGAAGGCCGTGG - Intronic
1176430395 21:6571818-6571840 CAGACGGGAGGGGAAGGCGGAGG - Intergenic
1176649540 21:9531831-9531853 GAGATTGCAGGAGAAGGGGGAGG - Intergenic
1176795888 21:13371166-13371188 GAGACTGCAGGAGAAGGGGGAGG + Intergenic
1177348632 21:19904972-19904994 AAGACACCAGGAGCAGGTGGAGG + Intergenic
1178264282 21:31127935-31127957 CAGACTCCAGGGGTAGGCTGGGG - Intronic
1178939173 21:36890574-36890596 GAGACACAAGGTGAAGGCGGTGG + Intronic
1179705789 21:43179280-43179302 CAGACGGGAGGGGAAGGCGGAGG - Intergenic
1179800625 21:43810083-43810105 CAGACTCCAGGCTATGGCTGTGG - Intergenic
1180305328 22:11068395-11068417 GAGACCACAGGAGAAGGGGGAGG - Intergenic
1180469946 22:15644394-15644416 CAGATTGCAGGAGAAGGGGAAGG - Intergenic
1180652349 22:17388475-17388497 CAGACTTCAGGAAAATGCGGAGG + Intronic
1180976395 22:19851168-19851190 CAGAACCCAGGAGAAAGTGGTGG + Exonic
1181051704 22:20241080-20241102 CAGCCCCCAGGAGGAGGCTGAGG - Intergenic
1181534774 22:23535670-23535692 CAGACGTCAGGAGAAGACAGTGG - Intergenic
1181801462 22:25350586-25350608 CGGCCACCAGGAGGAGGCGGAGG - Intergenic
1182420458 22:30246189-30246211 CAGACACCAGCAGATGGAGGCGG + Intronic
1183063939 22:35350995-35351017 CAGACACCGGGAGAAAGGGGCGG + Intergenic
1183654733 22:39177886-39177908 GAGGCACCAGGGGAAGGCGGAGG - Intergenic
1183705721 22:39473954-39473976 CAGACTCCAGGAGGCTCCGGAGG - Intronic
1184212576 22:43044606-43044628 CAGACGGCAGTAAAAGGCGGAGG - Intronic
1184554219 22:45224663-45224685 CAGGCACCAGTAGAAGGTGGTGG + Intronic
1184987728 22:48146745-48146767 CAGTGTCCAGGAGGAGGAGGAGG + Intergenic
1185086942 22:48746017-48746039 CAGCCTCCAGGAGACAGCGATGG + Intronic
950330695 3:12153841-12153863 GAGAATCCAGGAGAAGACTGGGG - Intronic
950887875 3:16376496-16376518 CAGCCTCCATGAGAAGATGGAGG + Intronic
952817402 3:37457555-37457577 CAGACTCTAGGGGAAGGTGTAGG + Intronic
952867606 3:37864241-37864263 CTGACTCCAGGAGCAGGAGCAGG + Intronic
955859352 3:63311074-63311096 CAGATGCCAGGAGAAAGTGGTGG + Intronic
956727955 3:72172038-72172060 CAGACTCCCAGAGGAGGCAGGGG + Intergenic
961792252 3:129384680-129384702 CAGATTCTTGGAGAAGGTGGAGG - Intergenic
966883582 3:184362672-184362694 CCGTGTCCAGGAGAAGGCAGTGG + Intronic
967915595 3:194576064-194576086 GAGAGGCCAGGAGGAGGCGGAGG - Intergenic
967920316 3:194609461-194609483 CAGACGCCAGGAGCAGCTGGTGG + Intronic
970252042 4:14126822-14126844 TAAACTCCAGTAGAAGGAGGTGG - Intergenic
971358270 4:25914045-25914067 CGGAATCCCGGGGAAGGCGGAGG + Intronic
973974138 4:56245134-56245156 TACACTCCATGAGAAGGGGGTGG - Intronic
978407811 4:108398496-108398518 CACACTCCAGGTGAATGCTGGGG - Intergenic
981076302 4:140595685-140595707 GAGACTCAAGGAGAAGGGTGGGG - Intergenic
981081309 4:140642063-140642085 CAGAGTCCGGGAGGGGGCGGAGG + Intronic
982105387 4:152007593-152007615 CAGACTTCAGGAGAAGGTAGAGG + Intergenic
982368617 4:154608326-154608348 CAGACTCCTGGAGAAAATGGTGG + Intronic
985609159 5:877103-877125 CAGACAGCTGGGGAAGGCGGGGG + Intronic
985677350 5:1238869-1238891 CAGGCTCCTGGAGCAGGCGCTGG - Intronic
985679912 5:1250463-1250485 CAGGTTCCAGGAGAAGGACGTGG + Intergenic
985725243 5:1512650-1512672 AAGACTCCAGGTGAAGGCGTGGG - Intronic
985731166 5:1549867-1549889 GGGACTCTAGGAGAAGGTGGCGG - Intergenic
987081314 5:14427647-14427669 GAGAATCCAGGACAAGGCCGCGG - Intronic
989520432 5:42394350-42394372 CAGAATTTAGGAGAAGGAGGAGG + Intergenic
989821609 5:45800223-45800245 CAGACACCAGGAGCAGGGGGAGG - Intergenic
993814473 5:92524363-92524385 CAGACTAACGGAGAAGGCCGGGG - Intergenic
995129458 5:108614242-108614264 CAGACTCCAGGAGAACTCCTTGG - Intergenic
995436766 5:112144892-112144914 CAGCCTGCAGGAGAAGAGGGAGG + Intronic
996531600 5:124533273-124533295 GAGACTCCAGGAGAAGTAGTAGG - Intergenic
997221097 5:132165091-132165113 CAGACTCCAGAATAAGTAGGTGG - Intergenic
997436708 5:133880887-133880909 CAAGCTCCAGGAGAAGGCCAGGG - Intergenic
999203647 5:149833345-149833367 CAGACTGCAGCAGCAGGAGGAGG + Exonic
999372339 5:151063691-151063713 CAGGCTCCGGCAGAAGGCAGAGG - Exonic
1000955151 5:167534373-167534395 AAGACTCCAAAAGAAGGCTGGGG + Intronic
1001029544 5:168251935-168251957 TAGCCTCCAGGAGCAGGCGGAGG + Intronic
1001395840 5:171419406-171419428 GAGCCGCCAGGAGAAGGAGGAGG + Intergenic
1001698649 5:173690817-173690839 CTGCCTCCAGGAGATGGCCGAGG + Intergenic
1002364001 5:178696027-178696049 CAGACTCGAGAAGATGGAGGTGG + Intergenic
1002682201 5:180975390-180975412 GAGACTCCAGGAGATGGCTAGGG + Intergenic
1002724229 5:181283746-181283768 GAGACCGCAGGAGAAGGGGGAGG - Intergenic
1003200687 6:3957572-3957594 CAGGCTCCAGGAGGAGGTGCTGG + Intergenic
1004214050 6:13684983-13685005 GTGAGTCCAGGAGAAGGCTGAGG - Intronic
1007237108 6:40398483-40398505 CAGAGTGCAGGGCAAGGCGGAGG + Intronic
1007390108 6:41546003-41546025 CAGACTCCAGGGGATGGCCGGGG + Intergenic
1007585942 6:42989559-42989581 CAGATGCCAGGAGAAGGGAGAGG - Intronic
1008439035 6:51511313-51511335 CAGATTCCAGGAGGAGGAAGTGG - Intergenic
1008990475 6:57595890-57595912 CATCCTCCAGGAAAAGGAGGGGG - Intronic
1009179049 6:60494436-60494458 CAGCCTCCAGGAAAAGGAGGGGG - Intergenic
1011124141 6:83987976-83987998 CAGAGTGCAGGAGTAGGTGGGGG + Intergenic
1016739056 6:147509081-147509103 CGGCCTCCAGGATACGGCGGCGG - Exonic
1016835660 6:148474100-148474122 CAATCTCCAGGAGAAGACGTTGG + Exonic
1017454304 6:154586665-154586687 CAAATTCCAGGAGAAGGCTTAGG - Intergenic
1017464010 6:154677915-154677937 CAGGCTCCAGCAGCAGACGGTGG + Intergenic
1019585098 7:1796557-1796579 CAGACTGAAGGAGGAGGAGGAGG + Intergenic
1020045600 7:5037882-5037904 CAGAGTCCAGAAGAAGGCCTTGG - Intronic
1020098383 7:5380914-5380936 CAGACTCCAGGAGGACCCAGGGG - Intronic
1020255892 7:6503088-6503110 CACCCTCCAGGAGAAGACAGAGG - Exonic
1020290999 7:6722075-6722097 CAGAGTCCAGAAGAAGGCCTTGG - Intergenic
1021483677 7:21145161-21145183 CAGAGTCAAGGAGAAGGTGGTGG - Intergenic
1022798021 7:33748408-33748430 CAGACGCCAGGAGAAGGTAGAGG - Intergenic
1025769927 7:64495080-64495102 AAGAGTCCAGGGGAAGGAGGAGG - Intergenic
1026640595 7:72121530-72121552 CAGAGTCCAGGAGGAAGCTGAGG - Intronic
1028240195 7:88410456-88410478 CAAACTCCAAGAGAATGCAGTGG + Intergenic
1029539520 7:101174387-101174409 CAGCCTCCAGAGGAAGGCTGGGG + Intronic
1030608837 7:111667282-111667304 CAAACTCAATGAGAAGGCAGAGG + Intergenic
1031915545 7:127559686-127559708 CAGAGTTCAGAAGAAGGTGGAGG - Intergenic
1031927152 7:127649902-127649924 AAGGATCCAGGAGAAGGCAGAGG + Intergenic
1032423734 7:131803527-131803549 AAGACCCCAGGAGAAGGAGGAGG + Intergenic
1032578622 7:133082064-133082086 CAGAAGCAAGGAGAAGGCGCCGG + Exonic
1033549830 7:142436889-142436911 CAGAATCTTGGAGAAGGCAGGGG - Intergenic
1033652328 7:143352505-143352527 CAGACTGCAGGAGCAGACGTGGG - Intergenic
1037755006 8:21704927-21704949 CAGACTCCAGGAGGGGTGGGAGG + Intronic
1038267366 8:26047324-26047346 CAGACCCCAGACGAAGGGGGTGG - Intergenic
1038430586 8:27496448-27496470 CAGAGTGCAGGAGAATGCAGAGG + Intronic
1039256278 8:35722457-35722479 CAGGGCCCAGGAGAAGGCTGGGG - Intronic
1039426882 8:37493521-37493543 CAGACTCCAGGAGAAGGCGGCGG + Intergenic
1041720044 8:60967511-60967533 CAGACCCCAGCAGAAGGGGACGG + Intergenic
1044820215 8:96151010-96151032 CACACTCCAGGAGGAGGGGTTGG - Intronic
1048624977 8:136175246-136175268 CAGTATCCAGAAGAAGGTGGAGG + Intergenic
1048717129 8:137282723-137282745 CAGGCTTCAGGAGAGGGTGGTGG - Intergenic
1049165384 8:141122330-141122352 CAAACTCCAGGCAAAGGCAGAGG - Intronic
1049202191 8:141345841-141345863 CAGATTCCTGGAGAGGTCGGTGG - Intergenic
1049263686 8:141653523-141653545 CAGACCCCAGGGGAAGGAGAGGG + Intergenic
1049778369 8:144416491-144416513 CAAACTCCAGGAGGCGGAGGAGG - Intronic
1050001636 9:1083741-1083763 GAGACTCCAGGAGCATGCGCGGG + Intergenic
1050324974 9:4490238-4490260 CAGACTCCAGTGGAAGGCTGTGG + Intergenic
1051894946 9:21976632-21976654 TTGAACCCAGGAGAAGGCGGAGG + Intronic
1053886367 9:42647183-42647205 GAGACCGCAGGAGAAGGGGGCGG - Intergenic
1054225387 9:62454632-62454654 GAGACCGCAGGAGAAGGGGGCGG - Intergenic
1056507586 9:87271582-87271604 CAGAGCCCAGGAGAAGGCCAGGG + Intergenic
1058423286 9:104853897-104853919 CAGACTCCAGGAATAGGGTGTGG - Intronic
1058814665 9:108672204-108672226 CAGTCTCAAAGAGAAGGCAGTGG + Intergenic
1059494349 9:114697165-114697187 CTGACTCCTGGAGAATGGGGGGG + Intergenic
1059646350 9:116272073-116272095 CAGACTCCAAGAGAAGGCAGAGG - Intronic
1060550435 9:124482448-124482470 CAGACTCCAGGAGAGAGAGCTGG + Exonic
1060679562 9:125549657-125549679 GATACACAAGGAGAAGGCGGAGG - Intronic
1060822937 9:126671911-126671933 CCCAGTCCAGGAGAAGGGGGTGG - Intronic
1061178324 9:129010261-129010283 TAGGCTCCAGGAGAAGACTGCGG - Intronic
1061288578 9:129638206-129638228 CGGACTCCAGGAGGAAGCGCAGG + Exonic
1061400407 9:130365274-130365296 CAGACCCGAAGAGAAGGTGGAGG - Intronic
1061553163 9:131349679-131349701 CAGACTCCAGGAGGAGCAGGTGG - Intergenic
1062672915 9:137722502-137722524 GAGTCTGCAGGAGAAGGAGGGGG + Intronic
1203627281 Un_KI270750v1:35379-35401 GAGATTGCAGGAGAAGGGGGAGG - Intergenic
1192282759 X:69702365-69702387 CAGTCCTCAGGAGAGGGCGGTGG + Intronic
1195257147 X:103101848-103101870 CAGACTCAGGGAGGCGGCGGGGG + Intergenic
1195454320 X:105051229-105051251 CAGGCGCCAGGAGAAGACAGAGG + Intronic
1198130929 X:133694355-133694377 CAGACACCAGGGGTAGGCTGTGG - Intronic
1199559401 X:149146955-149146977 CAGACACCAGGAGCAGGGAGAGG - Intergenic
1200854419 Y:7921845-7921867 CAGAGTCCAGGACAAAGAGGAGG + Intergenic
1201226497 Y:11823917-11823939 CAGACTCCAGGAGGCGGAGGTGG - Intergenic
1201275163 Y:12290115-12290137 CAGGCTCCATGAGGAGGCAGGGG + Intergenic