ID: 1039427333

View in Genome Browser
Species Human (GRCh38)
Location 8:37496438-37496460
Sequence CCCACCTCACATTGAGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039427333_1039427335 -9 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427335 8:37496452-37496474 TGAGGTGGGAAGCGAGAAAGTGG No data
1039427333_1039427336 7 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427336 8:37496468-37496490 AAAGTGGACCACATTGACAAAGG No data
1039427333_1039427337 14 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427337 8:37496475-37496497 ACCACATTGACAAAGGCTGAAGG No data
1039427333_1039427340 29 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427340 8:37496490-37496512 GCTGAAGGGTGAAGAATGATAGG No data
1039427333_1039427339 15 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427339 8:37496476-37496498 CCACATTGACAAAGGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039427333 Original CRISPR CCCACCTCACATTGAGTTTA AGG (reversed) Intergenic
No off target data available for this crispr