ID: 1039427336

View in Genome Browser
Species Human (GRCh38)
Location 8:37496468-37496490
Sequence AAAGTGGACCACATTGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039427333_1039427336 7 Left 1039427333 8:37496438-37496460 CCTTAAACTCAATGTGAGGTGGG No data
Right 1039427336 8:37496468-37496490 AAAGTGGACCACATTGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039427336 Original CRISPR AAAGTGGACCACATTGACAA AGG Intergenic
No off target data available for this crispr