ID: 1039429176

View in Genome Browser
Species Human (GRCh38)
Location 8:37512162-37512184
Sequence TGTTAGTAAGATTTCATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039429169_1039429176 20 Left 1039429169 8:37512119-37512141 CCTTGAAAGGACCATGGAACATA No data
Right 1039429176 8:37512162-37512184 TGTTAGTAAGATTTCATGTGGGG No data
1039429171_1039429176 9 Left 1039429171 8:37512130-37512152 CCATGGAACATAGCAGGTACATG No data
Right 1039429176 8:37512162-37512184 TGTTAGTAAGATTTCATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039429176 Original CRISPR TGTTAGTAAGATTTCATGTG GGG Intergenic
No off target data available for this crispr