ID: 1039433717

View in Genome Browser
Species Human (GRCh38)
Location 8:37545477-37545499
Sequence CGCCCCAGAGGCCTCTCCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039433708_1039433717 -4 Left 1039433708 8:37545458-37545480 CCCTCCTGGCCCATCCCCACGCC No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433710_1039433717 -8 Left 1039433710 8:37545462-37545484 CCTGGCCCATCCCCACGCCCCAG No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433702_1039433717 22 Left 1039433702 8:37545432-37545454 CCTCTCAGTTCCAGGAGGCTCCA No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433704_1039433717 12 Left 1039433704 8:37545442-37545464 CCAGGAGGCTCCAGGCCCCTCCT No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433707_1039433717 -3 Left 1039433707 8:37545457-37545479 CCCCTCCTGGCCCATCCCCACGC No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433706_1039433717 2 Left 1039433706 8:37545452-37545474 CCAGGCCCCTCCTGGCCCATCCC No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data
1039433709_1039433717 -5 Left 1039433709 8:37545459-37545481 CCTCCTGGCCCATCCCCACGCCC No data
Right 1039433717 8:37545477-37545499 CGCCCCAGAGGCCTCTCCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039433717 Original CRISPR CGCCCCAGAGGCCTCTCCGA AGG Intergenic