ID: 1039434220

View in Genome Browser
Species Human (GRCh38)
Location 8:37548484-37548506
Sequence CATGCTGGATCCTTTGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039434220_1039434225 6 Left 1039434220 8:37548484-37548506 CCCTGATCAAAGGATCCAGCATG No data
Right 1039434225 8:37548513-37548535 TCTGGAAAGACTGCTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039434220 Original CRISPR CATGCTGGATCCTTTGATCA GGG (reversed) Intergenic
No off target data available for this crispr