ID: 1039434351

View in Genome Browser
Species Human (GRCh38)
Location 8:37549352-37549374
Sequence AGCATGGAGCTCAGGTCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039434344_1039434351 6 Left 1039434344 8:37549323-37549345 CCCATCATCCCATAAATATGGAG No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data
1039434347_1039434351 -2 Left 1039434347 8:37549331-37549353 CCCATAAATATGGAGGCAATTAG No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data
1039434348_1039434351 -3 Left 1039434348 8:37549332-37549354 CCATAAATATGGAGGCAATTAGC No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data
1039434345_1039434351 5 Left 1039434345 8:37549324-37549346 CCATCATCCCATAAATATGGAGG No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data
1039434341_1039434351 19 Left 1039434341 8:37549310-37549332 CCACTGTGGTCCTCCCATCATCC No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data
1039434342_1039434351 9 Left 1039434342 8:37549320-37549342 CCTCCCATCATCCCATAAATATG No data
Right 1039434351 8:37549352-37549374 AGCATGGAGCTCAGGTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039434351 Original CRISPR AGCATGGAGCTCAGGTCCAA AGG Intergenic