ID: 1039438770

View in Genome Browser
Species Human (GRCh38)
Location 8:37580124-37580146
Sequence CCGCACCCAGAGATGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039438761_1039438770 2 Left 1039438761 8:37580099-37580121 CCTCCTCCAGCCAGCGAGACAGA No data
Right 1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG No data
1039438760_1039438770 19 Left 1039438760 8:37580082-37580104 CCACATCACTGCTCAGACCTCCT No data
Right 1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG No data
1039438764_1039438770 -8 Left 1039438764 8:37580109-37580131 CCAGCGAGACAGATCCCGCACCC No data
Right 1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG No data
1039438762_1039438770 -1 Left 1039438762 8:37580102-37580124 CCTCCAGCCAGCGAGACAGATCC No data
Right 1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG No data
1039438763_1039438770 -4 Left 1039438763 8:37580105-37580127 CCAGCCAGCGAGACAGATCCCGC No data
Right 1039438770 8:37580124-37580146 CCGCACCCAGAGATGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039438770 Original CRISPR CCGCACCCAGAGATGGGACA GGG Intergenic
No off target data available for this crispr