ID: 1039439459

View in Genome Browser
Species Human (GRCh38)
Location 8:37584629-37584651
Sequence GCCTATTTGGAGACAATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039439459_1039439466 29 Left 1039439459 8:37584629-37584651 CCACCCATTGTCTCCAAATAGGC No data
Right 1039439466 8:37584681-37584703 TCAAATTCAATCTGTCTAGGGGG No data
1039439459_1039439463 26 Left 1039439459 8:37584629-37584651 CCACCCATTGTCTCCAAATAGGC No data
Right 1039439463 8:37584678-37584700 TCTTCAAATTCAATCTGTCTAGG No data
1039439459_1039439464 27 Left 1039439459 8:37584629-37584651 CCACCCATTGTCTCCAAATAGGC No data
Right 1039439464 8:37584679-37584701 CTTCAAATTCAATCTGTCTAGGG No data
1039439459_1039439465 28 Left 1039439459 8:37584629-37584651 CCACCCATTGTCTCCAAATAGGC No data
Right 1039439465 8:37584680-37584702 TTCAAATTCAATCTGTCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039439459 Original CRISPR GCCTATTTGGAGACAATGGG TGG (reversed) Intergenic
No off target data available for this crispr