ID: 1039441063

View in Genome Browser
Species Human (GRCh38)
Location 8:37595602-37595624
Sequence AGGTGCCCCTGCTAGGGATC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039441056_1039441063 -8 Left 1039441056 8:37595587-37595609 CCAGGGAGTCTCCCCAGGTGCCC No data
Right 1039441063 8:37595602-37595624 AGGTGCCCCTGCTAGGGATCGGG No data
1039441054_1039441063 7 Left 1039441054 8:37595572-37595594 CCTGACACAGCATCACCAGGGAG No data
Right 1039441063 8:37595602-37595624 AGGTGCCCCTGCTAGGGATCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039441063 Original CRISPR AGGTGCCCCTGCTAGGGATC GGG Intergenic
No off target data available for this crispr