ID: 1039444552

View in Genome Browser
Species Human (GRCh38)
Location 8:37620717-37620739
Sequence ACACCCCACTCTCAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039444543_1039444552 -4 Left 1039444543 8:37620698-37620720 CCCACCCCCAGCCATCAAGACAC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444538_1039444552 8 Left 1039444538 8:37620686-37620708 CCCTTCACCCTCCCCACCCCCAG No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444541_1039444552 0 Left 1039444541 8:37620694-37620716 CCTCCCCACCCCCAGCCATCAAG No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444536_1039444552 29 Left 1039444536 8:37620665-37620687 CCCAAGAGGAATAAAACATTGCC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444547_1039444552 -10 Left 1039444547 8:37620704-37620726 CCCAGCCATCAAGACACCCCACT No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444546_1039444552 -9 Left 1039444546 8:37620703-37620725 CCCCAGCCATCAAGACACCCCAC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444545_1039444552 -8 Left 1039444545 8:37620702-37620724 CCCCCAGCCATCAAGACACCCCA No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444537_1039444552 28 Left 1039444537 8:37620666-37620688 CCAAGAGGAATAAAACATTGCCC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444544_1039444552 -5 Left 1039444544 8:37620699-37620721 CCACCCCCAGCCATCAAGACACC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444539_1039444552 7 Left 1039444539 8:37620687-37620709 CCTTCACCCTCCCCACCCCCAGC No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444542_1039444552 -3 Left 1039444542 8:37620697-37620719 CCCCACCCCCAGCCATCAAGACA No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data
1039444540_1039444552 1 Left 1039444540 8:37620693-37620715 CCCTCCCCACCCCCAGCCATCAA No data
Right 1039444552 8:37620717-37620739 ACACCCCACTCTCAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039444552 Original CRISPR ACACCCCACTCTCAGGAGGC AGG Intergenic
No off target data available for this crispr