ID: 1039446301

View in Genome Browser
Species Human (GRCh38)
Location 8:37635905-37635927
Sequence GTCCCACAGAACCCGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039446301_1039446304 -3 Left 1039446301 8:37635905-37635927 CCTTCATCCGGGTTCTGTGGGAC No data
Right 1039446304 8:37635925-37635947 GACAGTGTGTTCGTAAGACAGGG No data
1039446301_1039446306 -1 Left 1039446301 8:37635905-37635927 CCTTCATCCGGGTTCTGTGGGAC No data
Right 1039446306 8:37635927-37635949 CAGTGTGTTCGTAAGACAGGGGG No data
1039446301_1039446305 -2 Left 1039446301 8:37635905-37635927 CCTTCATCCGGGTTCTGTGGGAC No data
Right 1039446305 8:37635926-37635948 ACAGTGTGTTCGTAAGACAGGGG No data
1039446301_1039446303 -4 Left 1039446301 8:37635905-37635927 CCTTCATCCGGGTTCTGTGGGAC No data
Right 1039446303 8:37635924-37635946 GGACAGTGTGTTCGTAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039446301 Original CRISPR GTCCCACAGAACCCGGATGA AGG (reversed) Intergenic
No off target data available for this crispr