ID: 1039449341

View in Genome Browser
Species Human (GRCh38)
Location 8:37659099-37659121
Sequence GGCTGAACCTCCTGAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039449341_1039449344 -1 Left 1039449341 8:37659099-37659121 CCAGCTACTCAGGAGGTTCAGCC No data
Right 1039449344 8:37659121-37659143 CCAGAAGTTCAAGTCCAGCCTGG 0: 24
1: 1609
2: 24403
3: 98873
4: 165816
1039449341_1039449345 0 Left 1039449341 8:37659099-37659121 CCAGCTACTCAGGAGGTTCAGCC No data
Right 1039449345 8:37659122-37659144 CAGAAGTTCAAGTCCAGCCTGGG 0: 22
1: 1687
2: 22566
3: 42167
4: 59937

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039449341 Original CRISPR GGCTGAACCTCCTGAGTAGC TGG (reversed) Intergenic
No off target data available for this crispr