ID: 1039449800

View in Genome Browser
Species Human (GRCh38)
Location 8:37663297-37663319
Sequence GAGAATTCCCGCCAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039449800_1039449806 14 Left 1039449800 8:37663297-37663319 CCTTCTTGCTGGCGGGAATTCTC No data
Right 1039449806 8:37663334-37663356 GAGGCTGAGCATGTTCGCTCAGG No data
1039449800_1039449803 -8 Left 1039449800 8:37663297-37663319 CCTTCTTGCTGGCGGGAATTCTC No data
Right 1039449803 8:37663312-37663334 GAATTCTCTGCAGGGTCCTGAGG No data
1039449800_1039449804 -5 Left 1039449800 8:37663297-37663319 CCTTCTTGCTGGCGGGAATTCTC No data
Right 1039449804 8:37663315-37663337 TTCTCTGCAGGGTCCTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039449800 Original CRISPR GAGAATTCCCGCCAGCAAGA AGG (reversed) Intergenic
No off target data available for this crispr