ID: 1039449944

View in Genome Browser
Species Human (GRCh38)
Location 8:37664717-37664739
Sequence GTGTCACGGCACCTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039449944_1039449947 10 Left 1039449944 8:37664717-37664739 CCAGGCTGGAGGTGCCGTGACAC No data
Right 1039449947 8:37664750-37664772 CGCTACAACTTCCACTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039449944 Original CRISPR GTGTCACGGCACCTCCAGCC TGG (reversed) Intergenic
No off target data available for this crispr