ID: 1039451049

View in Genome Browser
Species Human (GRCh38)
Location 8:37675368-37675390
Sequence ATCTGGCTGTTCCTTCTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039451049_1039451059 -2 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451059 8:37675389-37675411 ATTAATGGGGTGGGCGGGCTGGG No data
1039451049_1039451056 -7 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451056 8:37675384-37675406 GCCAGATTAATGGGGTGGGCGGG No data
1039451049_1039451055 -8 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451049_1039451058 -3 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451058 8:37675388-37675410 GATTAATGGGGTGGGCGGGCTGG No data
1039451049_1039451060 -1 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451060 8:37675390-37675412 TTAATGGGGTGGGCGGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039451049 Original CRISPR ATCTGGCTGTTCCTTCTTGA CGG (reversed) Intergenic