ID: 1039451055

View in Genome Browser
Species Human (GRCh38)
Location 8:37675383-37675405
Sequence AGCCAGATTAATGGGGTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039451047_1039451055 -1 Left 1039451047 8:37675361-37675383 CCCTGAGCCGTCAAGAAGGAACA No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451043_1039451055 25 Left 1039451043 8:37675335-37675357 CCAGTACAGGATTTACGCTGCCC No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451048_1039451055 -2 Left 1039451048 8:37675362-37675384 CCTGAGCCGTCAAGAAGGAACAG No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451045_1039451055 4 Left 1039451045 8:37675356-37675378 CCTGACCCTGAGCCGTCAAGAAG No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451049_1039451055 -8 Left 1039451049 8:37675368-37675390 CCGTCAAGAAGGAACAGCCAGAT No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data
1039451044_1039451055 5 Left 1039451044 8:37675355-37675377 CCCTGACCCTGAGCCGTCAAGAA No data
Right 1039451055 8:37675383-37675405 AGCCAGATTAATGGGGTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039451055 Original CRISPR AGCCAGATTAATGGGGTGGG CGG Intergenic