ID: 1039452940

View in Genome Browser
Species Human (GRCh38)
Location 8:37690270-37690292
Sequence GGGGAGCTAGGCCGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039452940_1039452954 30 Left 1039452940 8:37690270-37690292 CCATCTCCCCGGCCTAGCTCCCC No data
Right 1039452954 8:37690323-37690345 CTCTTCAAAGCAGCTGCTCAAGG No data
1039452940_1039452946 -10 Left 1039452940 8:37690270-37690292 CCATCTCCCCGGCCTAGCTCCCC No data
Right 1039452946 8:37690283-37690305 CTAGCTCCCCAGGAGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039452940 Original CRISPR GGGGAGCTAGGCCGGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr