ID: 1039454320

View in Genome Browser
Species Human (GRCh38)
Location 8:37697383-37697405
Sequence TTTGCGGGAGTCGCCGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 33}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039454320_1039454324 -4 Left 1039454320 8:37697383-37697405 CCGGCGGCGGCGACTCCCGCAAA 0: 1
1: 0
2: 1
3: 8
4: 33
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039454320 Original CRISPR TTTGCGGGAGTCGCCGCCGC CGG (reversed) Exonic
904397740 1:30233842-30233864 TTTGTGGGAGTCCCCGATGCTGG + Intergenic
915616910 1:157046000-157046022 TCGGCGGGAGTCGCGGCCGCGGG - Intergenic
923506404 1:234609611-234609633 TTTGCGGCCGCCGCCGCCGCTGG - Intergenic
1066758086 10:38730395-38730417 TATGGGGCAGTCGCCGCCTCCGG + Intergenic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1076821162 10:132940433-132940455 AGTGCTGGAGTCGCCTCCGCAGG + Intronic
1084363593 11:68684342-68684364 TTTGGGGGAGTCTCTCCCGCGGG + Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1096024878 12:48351474-48351496 TTTGCGGGAGCCGTAGCCGCAGG + Intergenic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1097186062 12:57197127-57197149 GCTGTGGGGGTCGCCGCCGCGGG - Exonic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1103564333 12:121807949-121807971 TTTGGGGGAGTCTCAGCCCCAGG + Intronic
1127918536 15:63475145-63475167 TTTGCCGGAGTCGAGGCCCCTGG - Intergenic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1137454790 16:48610006-48610028 TGAGGGGGCGTCGCCGCCGCCGG - Exonic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1150255534 17:63741577-63741599 ATTGCGGGAGTCGAGGACGCGGG + Intronic
1163804161 19:19386042-19386064 CCTGAGGGAGTCGCCTCCGCGGG + Exonic
1168283767 19:55320512-55320534 TTTGGGGGGATCGCCGCTGCAGG - Intronic
925708416 2:6713398-6713420 TTTCCTGGAGTCGCTGCCTCTGG - Intergenic
929242422 2:39666172-39666194 GCTGCGGGACTCGCCCCCGCTGG + Exonic
932567934 2:72921067-72921089 TTCGCTGGAGAGGCCGCCGCCGG - Intronic
948265892 2:236635126-236635148 GTTGCAGGAGTCACCGGCGCTGG + Intergenic
1181586903 22:23857585-23857607 TGGGGGGGAGTCGCCGCCGCGGG - Intronic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
969723139 4:8904362-8904384 GTTGCGGGGGTGGCCGCGGCTGG - Intergenic
979565796 4:122152694-122152716 TATGAAGGAGTCGCCGCCGCAGG - Intronic
991488702 5:67163955-67163977 TATGCAGGAGGCGCCACCGCTGG + Exonic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
1007161150 6:39792629-39792651 TTTGCAGGAGCCGCCGACCCCGG + Intronic
1016755857 6:147685494-147685516 TTTGCTGGAGTCGCTTCCTCTGG + Intronic
1021510524 7:21428088-21428110 TTTCCGCGAATGGCCGCCGCTGG - Exonic
1036466557 8:9003114-9003136 GCTGCTGGAGTCGCCGCGGCCGG + Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1040415109 8:47188770-47188792 TTTCCAGGAGCCGCCACCGCTGG + Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1049353013 8:142174350-142174372 ATTGTGGGAGTCGCAGCCACTGG - Intergenic
1057314604 9:93960387-93960409 TCTGCGGGAGCCGCCGGGGCTGG - Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1185464458 X:346406-346428 CCTGCGGGAGGCGCCGCCCCAGG + Intronic