ID: 1039454324

View in Genome Browser
Species Human (GRCh38)
Location 8:37697402-37697424
Sequence CAAAGACAGCGGCTCCTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039454319_1039454324 5 Left 1039454319 8:37697374-37697396 CCAAGGGCTCCGGCGGCGGCGAC 0: 1
1: 1
2: 2
3: 27
4: 216
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175
1039454320_1039454324 -4 Left 1039454320 8:37697383-37697405 CCGGCGGCGGCGACTCCCGCAAA 0: 1
1: 0
2: 1
3: 8
4: 33
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175
1039454315_1039454324 12 Left 1039454315 8:37697367-37697389 CCCTACTCCAAGGGCTCCGGCGG 0: 1
1: 0
2: 0
3: 2
4: 62
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175
1039454317_1039454324 11 Left 1039454317 8:37697368-37697390 CCTACTCCAAGGGCTCCGGCGGC 0: 1
1: 0
2: 0
3: 7
4: 148
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175
1039454311_1039454324 23 Left 1039454311 8:37697356-37697378 CCAGCTTCAAGCCCTACTCCAAG 0: 1
1: 0
2: 2
3: 22
4: 298
Right 1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039454324 Original CRISPR CAAAGACAGCGGCTCCTCCT CGG Exonic
900570650 1:3356662-3356684 TAGAGACAGTGCCTCCTCCTGGG - Intronic
901092519 1:6651498-6651520 GAGAGACAGCAGCTCCTCTTTGG - Intronic
901600109 1:10416979-10417001 CAAAGACAGCTTCTCCTACATGG - Exonic
902377143 1:16035204-16035226 CATGGACAGCGGCTCCCTCTGGG - Intergenic
902382319 1:16058463-16058485 CATGGACAGCGGCTCCCTCTGGG - Exonic
904006607 1:27366382-27366404 CAGGGGCAGCGGCTCCGCCTCGG + Exonic
904470640 1:30733882-30733904 CAAAGACAGGGCTTCCTCGTAGG + Exonic
905013574 1:34762509-34762531 CAAAGGCAGAGGCTACTCCAGGG + Exonic
905409197 1:37756588-37756610 CAAAGACTGTGGCTACTGCTGGG - Intronic
907180812 1:52568461-52568483 CAAAAAAAGAGGCTACTCCTAGG - Intergenic
910251084 1:85200534-85200556 CAAGGACCACGGCTGCTCCTCGG - Exonic
910290321 1:85594371-85594393 CAAAGACAGCTGTGCCACCTGGG + Intergenic
913958160 1:143321496-143321518 CCAAGACAGTGGCAGCTCCTGGG + Intergenic
914052475 1:144146871-144146893 CCAAGACAGTGGCAGCTCCTGGG + Intergenic
914126722 1:144819670-144819692 CCAAGACAGTGGCAGCTCCTGGG - Intergenic
915592347 1:156877955-156877977 CAAAGAGATAGGCTCCTCCCTGG - Intronic
918494193 1:185115161-185115183 CACAGACAGCGGCGCCACCAGGG - Intergenic
920269480 1:204752321-204752343 CAGGGACAGAGGTTCCTCCTGGG - Intergenic
921021447 1:211239229-211239251 CTAAGACATCAGCTCTTCCTGGG + Intergenic
921488576 1:215746115-215746137 CATAGACAGTGGCTCCAGCTGGG - Intronic
1066759509 10:38739065-38739087 CAAAGACAGTGGCAGCTCCAGGG - Intergenic
1066962109 10:42233696-42233718 CAAAGACAGTGGCAGCTCCAGGG + Intergenic
1068131602 10:52902022-52902044 CACAGACAGTGGCTCCTGCTAGG + Intergenic
1068493290 10:57751440-57751462 CAAAGACAGCTGCTTCTAGTCGG + Intergenic
1069039070 10:63675752-63675774 CAAACACAGCTGAACCTCCTGGG + Intergenic
1076566203 10:131401121-131401143 CGAAAACACCGGCTCTTCCTTGG + Intergenic
1083698209 11:64456698-64456720 CAGAGACGGCGGCTACTCCTGGG + Intergenic
1084724790 11:70934436-70934458 CAAACACAGGGGCTCTGCCTGGG + Intronic
1091753228 12:3035502-3035524 CGAAGTCACCTGCTCCTCCTAGG - Intronic
1092290257 12:7156159-7156181 CATACACAGCAGCTCCTCCCTGG - Intronic
1092920675 12:13228910-13228932 CACAGACAGTGGCTCCACCTGGG + Intergenic
1096121413 12:49091670-49091692 CAGGGACAGCGGCTCAACCTGGG + Intronic
1096231508 12:49899332-49899354 CCAAGACAGAGGCTACTGCTGGG - Intronic
1101234470 12:102774906-102774928 AAAACACAGAGGCTCCCCCTGGG - Intergenic
1101533430 12:105595628-105595650 GAAAGACAGTCGCTCCTCCTTGG + Intergenic
1107217662 13:37940914-37940936 ACAAGACAGCGGCTCCACATGGG + Intergenic
1108488423 13:50952852-50952874 AAAAAACAGAGGCTCATCCTGGG - Intronic
1111856813 13:93648103-93648125 CAAAGCCAGCCCCTCCACCTGGG + Intronic
1113849874 13:113411997-113412019 CAAAGACAGCAGCACCTCTGGGG - Intergenic
1113900920 13:113797471-113797493 CACGGACAGAGGCTCCTGCTGGG - Intronic
1115681447 14:35743142-35743164 CACAGACAGTGGCCCCTGCTGGG + Intronic
1119780803 14:77275725-77275747 CACAGACAGCGCTTCCTGCTGGG + Exonic
1120722736 14:87905820-87905842 GACAGACAGCTGCACCTCCTGGG + Intronic
1121219488 14:92275005-92275027 CAAAGTCAGAGGCTTCTCCAAGG + Intergenic
1123004099 14:105313284-105313306 CACAGACAGCCTGTCCTCCTGGG + Exonic
1123874953 15:24614739-24614761 TAAAGACAGTGTCTCCACCTTGG - Intergenic
1123945797 15:25238326-25238348 CAAAGCCAGGGGCCCCACCTGGG - Intergenic
1124364870 15:29064284-29064306 CAAAGCCAGCTCCTCCTGCTGGG + Intronic
1125710067 15:41777616-41777638 CAAAGACAGCTACTCCTCTTGGG - Intronic
1125791637 15:42371286-42371308 ACAAGACAGCAGCTCCTCCTGGG + Intronic
1127598691 15:60513113-60513135 CAAGGACAGCGCGTCCTCTTTGG - Intronic
1131377843 15:91940155-91940177 CAATGACAGCAGCTCCTGCCTGG + Intronic
1131598371 15:93822745-93822767 CAAGTCCAGCGGCACCTCCTAGG - Intergenic
1131605849 15:93901328-93901350 CAAAGACACCGGCTGCACCAGGG - Intergenic
1132093927 15:98968112-98968134 CAGAGACAGCCGCTGCTCCAGGG - Intergenic
1134173217 16:11985550-11985572 CACAGGCAGCCGCTCCTCCATGG + Intronic
1138149883 16:54646977-54646999 CAAAAACAGGGGCTCAGCCTGGG - Intergenic
1138419237 16:56888457-56888479 CAGAGAGAGTGGCTCCTACTTGG + Intronic
1138921338 16:61533222-61533244 CAAAGATACCTGCTCATCCTGGG - Intergenic
1139361616 16:66403147-66403169 CTAATACAGCAGCTCCTCCCGGG - Exonic
1141424200 16:83934865-83934887 GAAAGCCAGCGGCCACTCCTGGG + Intronic
1141941067 16:87276533-87276555 CACACACAGAGTCTCCTCCTGGG - Intronic
1142711764 17:1727391-1727413 CAAAGACACAGGGACCTCCTTGG - Exonic
1143688695 17:8541261-8541283 CAAAGCCTGCTGCACCTCCTAGG + Intronic
1143727689 17:8860583-8860605 CAAAAACTGTGGCTTCTCCTGGG - Intronic
1151342854 17:73482788-73482810 CCAAGACGGCTACTCCTCCTGGG + Intronic
1152009136 17:77700206-77700228 CACGGGCAGCTGCTCCTCCTGGG + Intergenic
1152649306 17:81484554-81484576 GAAAGACAGGCGCTCCTCCTGGG + Intergenic
1153251695 18:3129272-3129294 CACAGAAAGCGGCTCCTCAGGGG - Exonic
1157798622 18:50600069-50600091 CAAATACAGTGGCTTCTACTCGG - Intronic
1158989533 18:62854488-62854510 CAGAGACAGTGAGTCCTCCTCGG - Intronic
1159774012 18:72583327-72583349 CAAAAGCAGCGGCTCTTTCTTGG + Intronic
1160973777 19:1782347-1782369 CAAGGATAGCTGCTCCTCCCCGG + Exonic
1162161733 19:8723112-8723134 CAAAGACAGTGGGACCACCTGGG + Intergenic
1162668666 19:12237113-12237135 CACAGACCGCAGCTCCTCCCAGG + Intronic
1163683610 19:18697613-18697635 CAAAGACAGCAGGGCCTCCCAGG - Intronic
1202691873 1_KI270712v1_random:99295-99317 CCAAGACAGTGGCAGCTCCTGGG + Intergenic
925022643 2:583860-583882 ACAAGGCAGCGGCGCCTCCTCGG + Intergenic
925412831 2:3649859-3649881 CACAGACAGCGGCCCCAGCTGGG + Intergenic
926108859 2:10169604-10169626 TGAAGACGGCGGCTGCTCCTTGG + Intronic
926649970 2:15332754-15332776 AAAATACAGTGCCTCCTCCTGGG + Intronic
929159286 2:38815538-38815560 CTAAGACACCATCTCCTCCTTGG + Exonic
929776286 2:44932997-44933019 CAAATACAGCTGCTCCTGCGAGG - Intergenic
929990588 2:46782822-46782844 CAGAAACAGAGACTCCTCCTTGG - Intergenic
931052449 2:58428955-58428977 CGAAGGCGGCGGCCCCTCCTGGG - Intergenic
932104559 2:68931010-68931032 CAAAGACAGGGGCTGCCCCAAGG - Intergenic
933954519 2:87354661-87354683 CCAAGACAGTGGCAGCTCCTGGG - Intergenic
934238713 2:90250881-90250903 CCAAGACAGTGGCAGCTCCTGGG - Intergenic
934274481 2:91565829-91565851 CCAAGACAGTGGCAGCTCCTGGG + Intergenic
937380524 2:121372565-121372587 CAAAGAGAGCATCTCCTTCTAGG + Intronic
938180192 2:129175576-129175598 CAAAGACATGGGGTCCTGCTTGG + Intergenic
938949176 2:136241460-136241482 AAAGGACAGCGGCTCACCCTGGG + Intergenic
941819113 2:169827459-169827481 CAGGGCCAGCGGCTCCTCCAGGG - Intronic
942299362 2:174547192-174547214 CAAAGACACCGCCGCCTCCATGG - Intergenic
943436244 2:187868474-187868496 GAAAAACACCAGCTCCTCCTGGG + Intergenic
946542054 2:220695526-220695548 CAAATACAGCAGCTCCTCTGGGG - Intergenic
947653480 2:231807510-231807532 CAAAGCCACCGCATCCTCCTCGG + Exonic
948774585 2:240277288-240277310 CAAGGACTGCAACTCCTCCTGGG + Intergenic
948776012 2:240289333-240289355 CACAGACGACGGCTCCTGCTCGG - Intergenic
948788158 2:240363800-240363822 CAAGGACAGCAGCTGCACCTCGG + Intergenic
949071014 2:242024204-242024226 TAAAGACAACAGCTCCTCCCTGG - Intergenic
949071125 2:242024906-242024928 GAAACACAGCAGCTCCTCCCCGG - Intergenic
1169093194 20:2873707-2873729 CGAGGACAGCGGCTCCGCCTCGG - Intronic
1171207795 20:23294642-23294664 CAAGGACTGAGGCTTCTCCTTGG - Intergenic
1173147705 20:40539147-40539169 CCAAGTCAGTGGCTCCTCCCTGG - Intergenic
1173930610 20:46814880-46814902 CAATGACAGCAGCTCCTCGATGG + Intergenic
1174004594 20:47400627-47400649 CAAAGGCAGAGTCTCCTCCAAGG - Intergenic
1174061032 20:47833271-47833293 CAATAGCACCGGCTCCTCCTTGG + Intergenic
1174798138 20:53539724-53539746 CAAAGACGGATGCCCCTCCTAGG + Intergenic
1175443526 20:59006349-59006371 CCAATACTGCGGCTCCTGCTGGG - Exonic
1178930961 21:36818705-36818727 CAAATACCGCCGCTCCTCCAAGG - Intronic
1181614850 22:24046853-24046875 CCAAGACATCAGCTCTTCCTGGG - Intronic
1183440210 22:37818694-37818716 CAACGCCAGCGGCGGCTCCTGGG - Intergenic
1185098819 22:48826627-48826649 CAAGGGCAGCGGCTCCTCCCAGG + Intronic
1185359955 22:50400182-50400204 GAAAGACAGCGTCTCCACCAAGG + Intronic
949255675 3:2043031-2043053 CAAAGACATGGGCTCTACCTAGG - Intergenic
951555441 3:23916803-23916825 CAAAGACAGCGGCTCCACCGCGG + Exonic
954328099 3:49874628-49874650 CAAGGGAAGCTGCTCCTCCTGGG + Intergenic
954707240 3:52487540-52487562 CAGAGCCAGGCGCTCCTCCTCGG - Exonic
955367416 3:58322984-58323006 CAATGACTGCAGCACCTCCTGGG + Intergenic
957158921 3:76583461-76583483 CAAATACAGTGGCTACTTCTTGG + Intronic
960670128 3:120147645-120147667 CAAAGGCAGCTGCTCCTGCAGGG - Intergenic
963246381 3:143067544-143067566 CAAAAGCCCCGGCTCCTCCTTGG - Intergenic
964624847 3:158748981-158749003 CAAACACAGCTGCTTCTCCATGG + Intronic
966442302 3:179959225-179959247 CAAAGCCCACGTCTCCTCCTGGG + Intronic
968526130 4:1058376-1058398 CACAGGCAGCGTCTCCTCCCTGG - Intronic
968725546 4:2246299-2246321 GAAAGAAAGCAGTTCCTCCTGGG - Intergenic
969156916 4:5219210-5219232 CCAAGACTGTGGCCCCTCCTGGG - Intronic
969217667 4:5735115-5735137 CAAAGGCAGAGGCTGCCCCTGGG - Intronic
969569732 4:8001425-8001447 CAACGGCAGCGGCTGCTCCCTGG + Intronic
969690579 4:8701920-8701942 CAGAGGCAGCGGCTCCTCCCTGG - Intergenic
969700496 4:8765131-8765153 GAGAGAAAGCGGCTCCCCCTGGG + Intergenic
971199706 4:24500710-24500732 AAAAGACAGAGGCTCTTCCTGGG - Intergenic
971584289 4:28385499-28385521 CAGAGACAGAGGCTGCTCATTGG - Intronic
975362073 4:73482439-73482461 CAAAGAAAGGAGCTCCTTCTAGG - Intronic
976475865 4:85482422-85482444 CAAAGACCCCAGCTCCTCCTTGG - Intronic
984710585 4:182880922-182880944 CAAGGCCAGCAGCTCCTCCAGGG - Intergenic
985863451 5:2492908-2492930 CACAGACAGCTGCTCCTTCCAGG - Intergenic
992160681 5:73997858-73997880 CACAGACAGCGGCCCCAGCTGGG + Intergenic
996327199 5:122288380-122288402 CACAGACAGCGGCTCTAGCTGGG - Intergenic
997580059 5:135011580-135011602 CAAGGACTGGGGCTTCTCCTGGG - Exonic
999695992 5:154189627-154189649 GCCAGCCAGCGGCTCCTCCTCGG - Intronic
1001003487 5:168029531-168029553 CAAAGCCAGCGGATCCACCAAGG - Intronic
1002516686 5:179764196-179764218 CAAAGAAGACAGCTCCTCCTCGG - Intronic
1003494567 6:6652846-6652868 CAAATACAACAGCTCCTCTTAGG + Intronic
1003617996 6:7672769-7672791 CAAAGACAACACCCCCTCCTTGG - Intergenic
1008008120 6:46434160-46434182 CAAAGATAGCTGCTTTTCCTAGG + Intronic
1011438650 6:87365176-87365198 TATAGACAGCAGCTCCCCCTGGG - Exonic
1013859204 6:114613751-114613773 GCAAGACAGCTGTTCCTCCTGGG - Intergenic
1015799094 6:137043127-137043149 CAAAGACAGGGTCTCACCCTTGG + Intronic
1015864713 6:137716522-137716544 CAGAAACAGAGACTCCTCCTGGG + Intergenic
1017009688 6:150054898-150054920 AAAAAACAATGGCTCCTCCTTGG + Intergenic
1017009747 6:150055249-150055271 GAACAACACCGGCTCCTCCTCGG + Intergenic
1017986066 6:159444195-159444217 CAAAGTCAGTGGCCCCTCCTGGG + Intergenic
1018183499 6:161244799-161244821 CAAAGACAGTGTTTCATCCTAGG - Intronic
1018374613 6:163199358-163199380 CTAGGACAGAGGCTCCTCCAGGG + Intronic
1019594662 7:1852886-1852908 CAGGGACAGCGGCCCGTCCTCGG - Intronic
1019633818 7:2064806-2064828 CCAGGACAGCGGCTTCTCCCAGG + Intronic
1019633822 7:2064824-2064846 CCAGGACAGCGGCTTCTCCTAGG + Intronic
1021304868 7:19020362-19020384 CACAGACAGTGGCCCCTGCTGGG + Intergenic
1022608499 7:31841890-31841912 CTAAAACAATGGCTCCTCCTGGG - Intronic
1023984090 7:45085315-45085337 TGCAGACAGCAGCTCCTCCTGGG - Exonic
1024865477 7:53900870-53900892 CACAGACAGTGGCTCCCGCTGGG - Intergenic
1024927231 7:54629981-54630003 CAGAGCTAGCAGCTCCTCCTAGG + Intergenic
1025932887 7:66010558-66010580 CAAATCCAGCGGTTGCTCCTCGG + Intergenic
1025950498 7:66141691-66141713 CAAATCCAGCGGCTGCTCCTCGG - Intronic
1026365753 7:69646720-69646742 CAAAGACAGCCTGGCCTCCTGGG - Intronic
1027132020 7:75597947-75597969 CAAAGCCACAGGCTGCTCCTGGG + Intronic
1029244619 7:99189969-99189991 CAAACACAGCAGCTGCTTCTTGG + Intronic
1033167804 7:139056472-139056494 CAAAGACAGCTCAACCTCCTGGG + Intronic
1034464309 7:151217380-151217402 CAAAGACAGTGGCCCCAGCTGGG + Intronic
1036683265 8:10891624-10891646 CAAGGGCAGCATCTCCTCCTGGG + Intergenic
1039443008 8:37608340-37608362 CAACCACAGTGGCTCCCCCTTGG - Intergenic
1039454324 8:37697402-37697424 CAAAGACAGCGGCTCCTCCTCGG + Exonic
1039882336 8:41632761-41632783 CCAACACCACGGCTCCTCCTTGG + Intergenic
1045390175 8:101707392-101707414 CAAAAACAGCTTATCCTCCTCGG - Intronic
1046683716 8:117201010-117201032 CAAATACATAGGCTCCTGCTTGG + Intergenic
1047232382 8:123008588-123008610 CAAAGCCAGAGGCTCCTCACAGG + Intergenic
1051249653 9:15146515-15146537 AAAAGCCAGCGGATCCTCTTTGG + Intergenic
1056013803 9:82360724-82360746 CACTGACAGCGGCTCCCACTGGG - Intergenic
1057220504 9:93255272-93255294 CCACGGCAGCTGCTCCTCCTTGG - Intronic
1060419538 9:123457880-123457902 GAAAGTGATCGGCTCCTCCTGGG + Exonic
1060776316 9:126377206-126377228 CAGAGACAGCTCCTACTCCTGGG + Intronic
1061720130 9:132546287-132546309 CACAGACAGCAGCTCCGCCTAGG - Intronic
1062055822 9:134469306-134469328 GCAAGACGGCGGCTCCTCCACGG - Intergenic
1062104713 9:134748443-134748465 CACAGACAGCAGCTTGTCCTTGG + Intronic
1062247241 9:135575455-135575477 CAGAGACAGCGTCTCCCCCTGGG + Intergenic
1186456214 X:9712060-9712082 AGAAGACAGCGGCTCCTTCAAGG - Intronic
1188275779 X:28198862-28198884 AAAAGACAGCAGCTCTTACTGGG - Intergenic
1194346562 X:92773050-92773072 CAAAGACAGGGACTCATTCTGGG + Intergenic
1200084394 X:153596313-153596335 CAGAGCCAGTGGCTCCTGCTGGG + Intronic
1200116862 X:153773284-153773306 CAAGGACCGCTGCTTCTCCTGGG - Exonic
1200138269 X:153885400-153885422 CAGAGCCAGGGGCTCCTCCCCGG - Intronic
1200654899 Y:5889694-5889716 CAAAGACAGGGACTCATTCTGGG + Intergenic