ID: 1039454388

View in Genome Browser
Species Human (GRCh38)
Location 8:37697645-37697667
Sequence GCCCAAGCCCAGCCCGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 397}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039454388 Original CRISPR GCCCAAGCCCAGCCCGGAGC CGG Exonic
900208085 1:1440012-1440034 GCCCCATCCCCGCCCAGAGCCGG + Exonic
900605865 1:3523286-3523308 GCCCAGAGCCAGCCAGGAGCAGG + Intronic
900609410 1:3538168-3538190 TCCAGAGCCCAGCCCAGAGCAGG + Intronic
900952332 1:5865046-5865068 CCCCAACCCCAGCCTGGAGACGG - Intronic
900983792 1:6061352-6061374 GCCCCCGCCCGGCCCGGTGCTGG - Intronic
901070202 1:6513175-6513197 GCCCAGGCCCAGCCTGGCCCAGG + Intronic
902138853 1:14334665-14334687 GCCCCAGCCCAGCCTTCAGCTGG - Intergenic
902199943 1:14825928-14825950 ACCCAAGGCCAGCACGTAGCAGG + Intronic
902612196 1:17603771-17603793 GCCCAAGCCCTGCCCGGCCCCGG - Intronic
902916683 1:19644096-19644118 GCCGAAGCTCAGCCCGGGGCGGG + Intronic
903184343 1:21620719-21620741 TCCCAGGCCCAGCCCCGAGCCGG - Intronic
903353801 1:22734092-22734114 GCCCAAGCCCAGGCTGGCCCTGG - Intronic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
904683938 1:32247593-32247615 GCCCAAGCCAAACCTGGACCAGG + Exonic
904792838 1:33036642-33036664 GCCCTGGACCTGCCCGGAGCGGG - Intronic
905449488 1:38047240-38047262 GCCCGAGCGCCTCCCGGAGCCGG - Intergenic
905630297 1:39514763-39514785 CCCCCAGCCCAGGGCGGAGCCGG + Intronic
905667462 1:39771426-39771448 CCCCCAGCCCAGGGCGGAGCCGG - Intronic
905867052 1:41382207-41382229 GCCCAGGCCCGGCCCGGTGCTGG + Exonic
905887946 1:41501797-41501819 GCCACAGCCCAGGCCTGAGCTGG - Intergenic
906563993 1:46783588-46783610 GCCCAGTACCAGCCCAGAGCAGG - Intronic
906802033 1:48746370-48746392 GCACAGGCCCAGCACAGAGCAGG + Intronic
907158943 1:52357615-52357637 GGCCAAGCGCAGCCAGGACCTGG - Exonic
907243518 1:53093337-53093359 GCCCAGGCTCAGCCCTGGGCCGG - Intronic
907323657 1:53621270-53621292 CCCCCAGCCCAGCCAGGAGCAGG + Intronic
908238662 1:62170857-62170879 GCCCAAGCACACCCCAGAGTAGG + Intergenic
908535549 1:65073199-65073221 TCACAAGCCCAGCCAGCAGCTGG - Intergenic
909282198 1:73770353-73770375 GCCCAGGCCCAGCGAGGACCTGG + Intergenic
910159759 1:84260316-84260338 GCCCACACTCAGCCCTGAGCAGG + Intergenic
910598385 1:89004686-89004708 CCCCAATACCAGCCCAGAGCTGG - Intergenic
912760072 1:112359043-112359065 GCCCACGTCCAGTCAGGAGCAGG + Intergenic
915479845 1:156177053-156177075 GCCCAAGCACAGCCCTGACTAGG + Exonic
915563211 1:156699738-156699760 GCCCCAAACCAGCCCAGAGCAGG - Exonic
916210704 1:162357355-162357377 AGCCAAGCCCAGCTCAGAGCAGG - Intronic
916890089 1:169106046-169106068 GTTCACGCCCAGCCGGGAGCTGG + Intronic
919802707 1:201363137-201363159 CCTCATGCCCAGCCCTGAGCTGG - Intronic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920038655 1:203082119-203082141 GGCCCAGCTGAGCCCGGAGCTGG + Intergenic
920244713 1:204578992-204579014 GCTCCAGCCCAGCCTGGATCAGG + Intergenic
922720482 1:227897531-227897553 GCCCATCACCAGCCAGGAGCCGG - Intergenic
1062795104 10:339002-339024 GCCCAAGCCCACGTCGGAGGAGG - Intronic
1063179447 10:3584488-3584510 GCCCAAGACCGTCCCGGAACGGG + Intergenic
1063190849 10:3693402-3693424 GCACAACCCCAGCACGCAGCAGG - Intergenic
1063709058 10:8459370-8459392 GGCCCAGCCCAGCATGGAGCGGG - Intergenic
1064086379 10:12349263-12349285 GCCCCAGCCCCTCCGGGAGCTGG - Intergenic
1064259738 10:13775696-13775718 GACCAAGTCCAGGCTGGAGCAGG + Intronic
1064332256 10:14404993-14405015 TCCCATGCCCAGCCTAGAGCAGG + Intronic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1065774608 10:29107674-29107696 TCCCAAGCCCAGCTCTGATCTGG - Intergenic
1065883606 10:30058817-30058839 TCCCACGCGCAGCCAGGAGCCGG + Intronic
1067082181 10:43218023-43218045 GCCCCACCCCAGCTGGGAGCCGG + Intronic
1067300218 10:45001100-45001122 GGCCAGGCCCTGCCCGGAGGCGG - Intronic
1067431379 10:46248213-46248235 CCCCAGGCCCAGCCAGTAGCAGG + Intergenic
1069660920 10:70122982-70123004 CCCCAAGCCCTGCCTGGTGCTGG - Intronic
1069806854 10:71131683-71131705 GTCCAAGTCCAGCCCAGAGAGGG - Intergenic
1069893357 10:71665655-71665677 GCACAAGGACAGCCAGGAGCAGG + Intronic
1069960969 10:72079281-72079303 GCCCAATCCCAGCCCACAGGTGG + Intronic
1070645581 10:78199944-78199966 GCCCAAGAGCAGGCAGGAGCTGG - Intergenic
1070645984 10:78202917-78202939 GCCCAGGGCCAGCTCAGAGCAGG + Intergenic
1070764365 10:79048096-79048118 GAACCAGCCCAGCCCTGAGCAGG + Intergenic
1070887661 10:79919787-79919809 GCCCAAGTCCAGCCAAGAGATGG + Intergenic
1071484792 10:86091826-86091848 CCCCAATACCAGCCCCGAGCCGG + Intronic
1071568060 10:86681621-86681643 GGCCAAGACCAGCCCAGAGGGGG + Exonic
1072436188 10:95416428-95416450 GGCTGAGCCCAGCCCGTAGCAGG + Intronic
1074156626 10:110805666-110805688 GCCCCAGCCCTGCCCGCACCTGG - Intronic
1074546285 10:114404307-114404329 GCCCCCACCCAGCCCGGACCTGG - Intronic
1075557764 10:123445683-123445705 GCCCCAGCTCAGCCTAGAGCGGG + Intergenic
1075982687 10:126755183-126755205 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1076290824 10:129344184-129344206 GCCCAGACACAGCCAGGAGCAGG - Intergenic
1076364874 10:129915269-129915291 CCCAGGGCCCAGCCCGGAGCAGG + Intronic
1076543169 10:131227213-131227235 GCCGAAGCCCAACCCAGTGCTGG + Intronic
1076634184 10:131872135-131872157 GCCCATGGCAAACCCGGAGCAGG + Intergenic
1076679246 10:132163202-132163224 GCCCCAGCACATCCTGGAGCTGG + Exonic
1076824268 10:132959374-132959396 GCCCTCGCCATGCCCGGAGCTGG - Intergenic
1076904515 10:133355446-133355468 AGCCAAGCCCAGCACTGAGCTGG + Exonic
1077026038 11:440412-440434 GCCCAGATCCAGCCTGGAGCTGG + Intronic
1077034370 11:487717-487739 GCCCAAGCCCAGGCAGGGGCGGG - Intronic
1077284269 11:1758847-1758869 GCCCAACCCCAGCCCTCAGGTGG - Intronic
1077286151 11:1766897-1766919 GCCCACGGCCAGCCTGGACCTGG + Intergenic
1077341317 11:2027641-2027663 GCACAGGCTCAGCCCGGGGCCGG + Intergenic
1077363988 11:2154205-2154227 GCCCATGCCCAGCCAGGGGGAGG + Intronic
1077608200 11:3626501-3626523 GGGCAAGCCCAGCCAGGAGGAGG - Intergenic
1079095610 11:17508180-17508202 CCCAGAGCCCAGCCAGGAGCTGG - Intronic
1079451192 11:20601218-20601240 TCCCAGGACGAGCCCGGAGCAGG + Exonic
1080614962 11:33937737-33937759 CTCCAAGCCCAGGCTGGAGCAGG - Intergenic
1081616812 11:44596162-44596184 GCCCAAGCCCGGCCTGGGGTGGG - Intronic
1081699892 11:45146495-45146517 GCCCGCGCCCTGCCCGGAGGGGG - Intronic
1082179705 11:49102680-49102702 GCACAAGGCCTGCCAGGAGCAGG + Intergenic
1083454833 11:62771647-62771669 GGCCTAGCCCAGCCCAGATCGGG - Intronic
1083611452 11:64006357-64006379 GCTCAAGCCTAGCACAGAGCCGG - Intronic
1083936468 11:65872450-65872472 GCCCAAGCACGGTCCTGAGCGGG - Intronic
1084267810 11:68013921-68013943 GCCCCAGGCCAGCCCTCAGCTGG - Intronic
1084296641 11:68216460-68216482 GTGCCAGCCTAGCCCGGAGCTGG + Intergenic
1084611599 11:70206637-70206659 GCCCAAGCCCGGCCTGGTGCGGG - Exonic
1085020697 11:73205045-73205067 CCCCAAGCCCAGGCCAGGGCAGG - Intergenic
1085395269 11:76203857-76203879 GCCCCAGCACAGCTGGGAGCAGG - Intronic
1085521326 11:77140553-77140575 CCCAGAGCCCAGCCCAGAGCGGG - Intronic
1085642500 11:78201197-78201219 GCCCTAGCCCAGCCTGGTGGAGG - Intronic
1086685577 11:89730232-89730254 GCACAAGGCCTGCCAGGAGCAGG - Intergenic
1090832330 11:130428186-130428208 GCCCCGGCCCGGCCCGCAGCCGG - Exonic
1090910124 11:131111379-131111401 GCCCATGAGCAGCCAGGAGCAGG + Intergenic
1202824302 11_KI270721v1_random:82830-82852 GCACAGGCTCAGCCCGGGGCCGG + Intergenic
1091397681 12:163636-163658 GCCCCAGCCCAGCCCAGTCCCGG - Intronic
1091589386 12:1834442-1834464 GCCCAAGCCCGGGGCTGAGCCGG + Exonic
1092147146 12:6222549-6222571 GGCCAGGCCAAGCCCGGAGTCGG - Intronic
1092209292 12:6635952-6635974 AGCCCAGCCCAGCCCAGAGCAGG - Exonic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1092861749 12:12724903-12724925 TCCCCAGGCCAGCCCGGATCCGG - Intergenic
1094501373 12:31023701-31023723 CCCCAGTGCCAGCCCGGAGCTGG + Intergenic
1094753527 12:33439933-33439955 GTCCAATCGCAGCCCGGCGCGGG + Intergenic
1096699235 12:53371413-53371435 CCTCAGGCCCAGCCCGGAGCTGG - Intergenic
1096789679 12:54037000-54037022 GCCCAAACCCTGCCGGGAGGAGG - Intronic
1097195453 12:57240292-57240314 CCCCAAGCCCGGCCAGGAGCCGG - Intronic
1098465840 12:70784378-70784400 GCCCAGGCCCAGCAAGGATCTGG - Intronic
1100679829 12:96907247-96907269 CCGGAAGCCCAGCGCGGAGCCGG + Intronic
1101807429 12:108076512-108076534 GCCCATGCCTAGCACAGAGCAGG - Intergenic
1102019838 12:109674680-109674702 CACCAAGGCCAGCCCAGAGCTGG + Intergenic
1102257938 12:111426955-111426977 GGCCCAGCCCAGCCTGGAGCTGG - Intronic
1102538683 12:113601890-113601912 GGCCAAGCCAAGCCAGGACCGGG + Intergenic
1102789899 12:115636107-115636129 GCCCCACCCCAGCCAGGAACTGG - Intergenic
1102874117 12:116436609-116436631 GCCCATGCCCGGCCTGCAGCAGG + Intergenic
1103059873 12:117849927-117849949 GCCCCAGCTCAACCCAGAGCTGG - Intronic
1103321262 12:120093920-120093942 GTCCAACCCCAGCCCTGAGCAGG - Exonic
1103324658 12:120112341-120112363 GCCATAGCCCAGGCAGGAGCAGG - Intronic
1103905434 12:124325196-124325218 GCACAGGGCCAGCCCGGGGCGGG + Exonic
1104417280 12:128605999-128606021 GCCCTAGGCCAGCCCAAAGCGGG - Intronic
1104568311 12:129903973-129903995 GCCCCAGCCGGGCCCGGGGCCGG - Intergenic
1105541705 13:21321592-21321614 GCCCGAGCCCAGCCCCTAGGAGG + Intergenic
1105768061 13:23579871-23579893 GCCCAAGCCCGACCCGGCCCCGG + Intronic
1105809160 13:23979531-23979553 GCCCGGGCTGAGCCCGGAGCAGG - Intergenic
1105827730 13:24137304-24137326 GCAAAGGCCCAGCCAGGAGCAGG - Intronic
1106121005 13:26860079-26860101 GACCAACCCCAGCCCAGGGCTGG - Intergenic
1106133019 13:26954911-26954933 GCCCCAGCCATGCCTGGAGCTGG + Intergenic
1106564715 13:30874247-30874269 GCCAAAGCCTTGCCCGGGGCTGG + Intergenic
1112657990 13:101473607-101473629 CTCCAAGCCCAGCACAGAGCAGG - Intronic
1113330278 13:109319791-109319813 CCCCAGTACCAGCCCGGAGCAGG + Intergenic
1113661356 13:112108239-112108261 GCCCAGGCCCAGCCAGGGGCTGG - Intergenic
1115849971 14:37583672-37583694 GCCCAACCCCGGCGCGGAGCTGG - Intergenic
1118615519 14:67572252-67572274 GCCCAGGCCCAGCCCGTCGGTGG - Exonic
1118816412 14:69317383-69317405 CCCCAAGCTCAGAGCGGAGCTGG - Intronic
1119601932 14:75982369-75982391 GGCCAGGCCCAACCCGGGGCAGG + Intronic
1121127824 14:91418728-91418750 GGCCGAGACCAGCCTGGAGCCGG - Intergenic
1121691034 14:95877105-95877127 GCCGCAGCCCGGCCCGGACCCGG - Intergenic
1122082403 14:99274678-99274700 GCCCCTGCCCAGCCTTGAGCCGG + Intergenic
1122206182 14:100149130-100149152 GCCCAGGCCCAGGAAGGAGCTGG + Exonic
1122620981 14:103057546-103057568 GCCCGACCCCAGCCCCGACCCGG + Intergenic
1122794315 14:104198375-104198397 GGCCAAGCCCAGCCCAGCTCAGG - Intergenic
1123019049 14:105389063-105389085 GCCCAAGCCCAGGCTGCAGTGGG + Intronic
1123055676 14:105568552-105568574 GCCCCAGCCCAGGGGGGAGCCGG + Intergenic
1123080035 14:105688071-105688093 GCCCCAGCCCAGGGGGGAGCCGG + Intergenic
1124957183 15:34367198-34367220 GCCCGGGCCCCGCCCGGTGCAGG + Exonic
1127299943 15:57643243-57643265 ACCCAGCCCCAGCACGGAGCGGG - Intronic
1127551118 15:60039358-60039380 GCCAAAGCCAAGCACAGAGCTGG - Intronic
1127973918 15:63983411-63983433 GCCTAAGCTCAGCCCAGAGGAGG - Intronic
1128682591 15:69662578-69662600 CCCCAAGGCCAGCCCAGGGCTGG - Intergenic
1128875066 15:71194963-71194985 TCCGAAGCCCAGCACGGGGCTGG + Intronic
1129167010 15:73784445-73784467 GTCAAAGCCCAGCCCAGGGCTGG - Intergenic
1129252885 15:74318495-74318517 GACCAAGCCCAGCCCTGAGCTGG - Intronic
1129672163 15:77613415-77613437 GCAAAAAGCCAGCCCGGAGCTGG + Exonic
1130032847 15:80332062-80332084 GCCCAGTGCCAGCCCGGTGCGGG + Intergenic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1132933773 16:2471241-2471263 GCCCGGGCCCAGCCGGGGGCGGG - Intergenic
1132933883 16:2471557-2471579 GCCCCAGCCCGGCCCAGAGGTGG - Exonic
1132935948 16:2481155-2481177 GCCCCACCCCAGCCCGGGTCAGG - Intronic
1133462609 16:6000334-6000356 GCCAAAGCTCAGCCCTGACCAGG + Intergenic
1133999157 16:10769179-10769201 GACCCACCCCATCCCGGAGCTGG - Exonic
1134746610 16:16593664-16593686 GCGCAAGCCCAGACTGGAGCTGG + Intergenic
1134998864 16:18760016-18760038 GCGCAAGCCCAGACTGGAGCTGG - Intergenic
1135203872 16:20465530-20465552 TCCCAAGCCCAGCCCTGTGGTGG + Exonic
1135215132 16:20559412-20559434 TCCCAAGCCCAGCCCTGTGGTGG - Exonic
1135564417 16:23500503-23500525 GCCCAATGCCAGCCCCAAGCGGG + Intronic
1136524604 16:30820961-30820983 CCCCACGCCCACCCCGGAGAGGG + Intergenic
1136998561 16:35208224-35208246 GCGCTCCCCCAGCCCGGAGCAGG - Intergenic
1138038071 16:53628409-53628431 GCCCATGCCCAGCCTGAAGAAGG - Intronic
1138579003 16:57927408-57927430 GCCTGAGCCCAGCCCTGAGAGGG - Intronic
1139506423 16:67400241-67400263 GCCCAAGGCCAGCCCCCACCAGG - Intronic
1139850885 16:69951137-69951159 GGCCAGGCCGAGGCCGGAGCAGG + Intronic
1139879867 16:70174049-70174071 GGCCAGGCCGAGGCCGGAGCAGG + Intronic
1140372652 16:74421499-74421521 GGCCAGGCCGAGGCCGGAGCAGG - Intronic
1141749269 16:85947287-85947309 GGCCAAGTCCAGCCCAGAGTGGG - Intergenic
1142694843 17:1628062-1628084 ACCCCAGCCCTGCCCGGACCTGG + Exonic
1143258833 17:5583686-5583708 GCCCAAGCCCAGGAAGGGGCAGG - Exonic
1143300151 17:5902820-5902842 GCCCAAGCCCAGCCCTGGGGAGG - Intronic
1144605732 17:16663945-16663967 GACCAAGCCCAGCCCTTAGAGGG - Intergenic
1144786794 17:17836611-17836633 GCGCGAGCACAGCACGGAGCTGG + Intronic
1144872147 17:18378073-18378095 GCCCAGGACCAGCCCCGTGCTGG + Intronic
1146017724 17:29247232-29247254 GCCCAATACCAGCCAGGAGGAGG + Intronic
1146456231 17:33011944-33011966 GCCCAAGCATGGCCAGGAGCTGG - Intergenic
1147382240 17:40062855-40062877 GCCCGAGCCCCAGCCGGAGCGGG + Exonic
1147674899 17:42198406-42198428 CACCATGCCCAGCCTGGAGCTGG - Intergenic
1147725249 17:42562778-42562800 GCCCCAGTCCAGCCCCGTGCAGG + Exonic
1149866454 17:60153830-60153852 GCCCATCCCCAGCCCCGGGCAGG - Intronic
1150168342 17:62966167-62966189 TCCCCACCCCAGCCCGGAGGGGG + Intergenic
1151662250 17:75525286-75525308 GCCAGAGCCCAGCCCAGAGAGGG - Intronic
1151696817 17:75722075-75722097 GAGCAAGCCCTGCCTGGAGCCGG - Intronic
1151749133 17:76026983-76027005 GCCCAGGACCAGCCCCGTGCTGG - Intronic
1151757249 17:76081984-76082006 GCCCCAGCCCAGCCCCGAGAGGG + Exonic
1151758456 17:76087797-76087819 GCCCAGGGCCAGCCCAGGGCTGG + Intronic
1151802163 17:76384922-76384944 GCCAAAGCCAAGCCCGAACCGGG - Exonic
1152574493 17:81134103-81134125 GCCCAACCCCAGGCTGGAGTGGG + Intronic
1152633538 17:81421226-81421248 GGCCAAGGCCAGCCGGGAACCGG - Intronic
1156458667 18:37308943-37308965 GTGCAAGCCCAGCCAGCAGCAGG - Intronic
1157752962 18:50194796-50194818 GCCCGAGCCCCGCCCGGCCCGGG - Exonic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160605380 18:80045966-80045988 GGCCAAGCCCCGCCTGGAGCAGG + Exonic
1160680598 19:410247-410269 CCCCAGGACCAACCCGGAGCCGG + Intergenic
1160992376 19:1864948-1864970 GTCCATGCCCAACCCAGAGCAGG - Intergenic
1161457545 19:4377068-4377090 GCCCATTCCCAGCCTGGAGCTGG + Intronic
1161861660 19:6802477-6802499 GCCCCACCGCAGCCCGGAGAGGG + Intronic
1162396403 19:10420335-10420357 GCCCCCTCCCAGCCCGGAGCGGG + Intronic
1162917264 19:13881216-13881238 GCCCAAGCCCACCCAGGACATGG - Intergenic
1163154462 19:15432464-15432486 GCCCAAGGCCGAGCCGGAGCCGG - Intronic
1163214116 19:15863435-15863457 CCCTAAGCCCAGCCCTGAGCTGG - Intergenic
1163492235 19:17623661-17623683 GCCCCAGCCCAGCCCAGAAGAGG + Intronic
1163509659 19:17727202-17727224 GGCCACGCCCAGCCTGGAGCTGG + Exonic
1163521671 19:17795395-17795417 TCCCAAGGCCAGCTCGGACCTGG + Intronic
1163592559 19:18202795-18202817 GCCCAAGCCCAGGCAGAAGATGG + Intronic
1164069168 19:21750668-21750690 GCCGGAGCCCTGCCCGGGGCGGG + Intronic
1164086720 19:21909307-21909329 GCCTCAGCCCTGCCCGGAGGGGG + Intergenic
1165127808 19:33613077-33613099 GCCCAAGCCCAAGCCCTAGCTGG - Intergenic
1166209591 19:41297655-41297677 GCCCAAGCCCACCCCAGAGTAGG + Intronic
1166752553 19:45171380-45171402 GCCAGAGCCCAGCCCAGAGCCGG + Intronic
1166898010 19:46036201-46036223 GCCCAGGCCCAGCGAGGATCAGG + Intergenic
1167277017 19:48545012-48545034 GCCCCAGCCCAGCTCAGGGCAGG + Intergenic
1168108845 19:54180803-54180825 GCCAAAGCCCGGGCCGGAGGCGG - Exonic
1168351784 19:55680147-55680169 GCCCAAGCCCCGCCTGGCACTGG - Intronic
925984680 2:9206542-9206564 GCCCATGCCCCGCCCCCAGCCGG - Intergenic
926625290 2:15085511-15085533 GCCCAGGCCCAGCAAGGACCTGG + Intergenic
926915939 2:17892734-17892756 CCCCAGGACCAGCCCAGAGCTGG - Intronic
927519542 2:23690582-23690604 GGCCAGGCCCAGCCCGAGGCAGG + Intronic
927562557 2:24084245-24084267 GGCCAAGCCGAGCCCGGGGGAGG - Exonic
927854478 2:26519220-26519242 TCTCCAGCCCAGCCCAGAGCTGG - Intronic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
928580236 2:32700082-32700104 GCCCATGCCCACTCCGGAGAGGG + Intronic
929148909 2:38730630-38730652 CACCACGCCCAGCCCGGAGAAGG - Intronic
930769936 2:55120738-55120760 GCCCGAGCCCTGCCTGGAGATGG - Intergenic
932522363 2:72427455-72427477 GCCCACTCCCATCTCGGAGCAGG + Intronic
932560379 2:72862680-72862702 GCCAAAGCGCAGCCGGGACCTGG - Intergenic
932599360 2:73113064-73113086 GCCGCAGACCAGCCCGGAGCGGG + Intronic
932682298 2:73836547-73836569 GTCCAGCCCCAGCCCTGAGCAGG + Intronic
932791054 2:74654643-74654665 GCCCACGCCCCGCCGGGACCGGG + Intronic
932794092 2:74680142-74680164 GCCCAAGCCCAGCCCACATTCGG + Exonic
933721848 2:85401999-85402021 GCCCAAGCACAGCCCTGGGCAGG + Intronic
934754782 2:96817263-96817285 GCCGAAGTCCAGCACGGTGCTGG - Exonic
935677041 2:105603688-105603710 TGACAAGCCCAGCCCAGAGCTGG + Intergenic
937302591 2:120852342-120852364 ACCCAAGCCCAGCACAGAGCTGG - Intronic
938536271 2:132252365-132252387 CCCCAGGCACAGCCCAGAGCTGG + Intronic
942045539 2:172097287-172097309 GCCTCAGCCCACCCCGGAGCTGG + Intergenic
942144964 2:173017886-173017908 CCCTGAGCCCAGCCCTGAGCAGG + Intronic
944873984 2:203943456-203943478 CCCCAATACCAGCCCAGAGCCGG - Intronic
945245244 2:207711697-207711719 GCCCGAGCCCTGCCCGGGGCCGG + Intronic
946372506 2:219289555-219289577 CCCCAGCCTCAGCCCGGAGCCGG - Intergenic
947669043 2:231925362-231925384 GCCCAGCCCCAGCCCGGCCCGGG - Intronic
948066862 2:235087516-235087538 GGGAGAGCCCAGCCCGGAGCAGG - Intergenic
948082862 2:235220640-235220662 GTCACAGCCCAGCCCAGAGCAGG + Intergenic
948432801 2:237930755-237930777 GCACCAGCTCAGCCCGTAGCTGG - Intergenic
948508687 2:238448629-238448651 TCCCCAGCCCTGCCCGGTGCAGG + Exonic
948551792 2:238777883-238777905 CCCCAAGACCACCTCGGAGCTGG - Intergenic
948581098 2:238987720-238987742 CCCCAGGCGCTGCCCGGAGCGGG - Intergenic
948746035 2:240095228-240095250 GCCCTAACCCCACCCGGAGCAGG + Intergenic
1170002614 20:11631890-11631912 GCCAAAGCCCTGCCCTCAGCAGG + Intergenic
1171412936 20:24958724-24958746 GCACAAACCCAGCACGGGGCAGG + Intronic
1172182562 20:33012563-33012585 ACCCAAGTCCTGCCCGAAGCGGG + Intronic
1172389803 20:34559024-34559046 GCCCCCGCCCAGGCCGGAGCTGG - Intronic
1172764408 20:37343660-37343682 GCCCATGCCCAGCACGGAGCAGG - Intergenic
1172838107 20:37886028-37886050 GCCCAGGCCAGGCACGGAGCTGG + Intergenic
1173579504 20:44137246-44137268 GCCCCACCCCACCCGGGAGCCGG + Intronic
1173737946 20:45374974-45374996 CCCCAAGCCAGGCCCAGAGCTGG - Intronic
1175332680 20:58176031-58176053 GCGCAAGCCAAGCCAGGACCTGG - Intergenic
1175766573 20:61596639-61596661 TCCCAAACCCAGACCAGAGCTGG - Intronic
1175873838 20:62220360-62220382 GCCCCCGCCCCGCCCGGCGCCGG + Intergenic
1176159573 20:63641498-63641520 GCCGAAGGCCAGCCCGGATGAGG - Intronic
1179529607 21:42009826-42009848 CCCCAACCCCTGCCCGGAACAGG + Intronic
1179568151 21:42261901-42261923 GTCCCAGCCCAGCCCAGTGCAGG + Intronic
1179621141 21:42617207-42617229 GCACAAGCGCAGCCCGGTGAAGG + Intergenic
1179882863 21:44300613-44300635 GCCCCCGCCCAGCCGGGAGGAGG - Intronic
1180009958 21:45042960-45042982 GCCCAAGGGCAGCCTGGAGGAGG + Intergenic
1180061572 21:45388083-45388105 GCCCAGGCCCAGGCTGGAGATGG + Intergenic
1180154538 21:45971597-45971619 CCCCAGACCCAGCCCAGAGCAGG + Intergenic
1180611382 22:17100423-17100445 GCCCAAGCCCATCCCTGATGGGG + Exonic
1181078848 22:20400770-20400792 GCCGACGCCCAGCCTGGGGCTGG - Intronic
1181265415 22:21628335-21628357 GTCCTGGCCCAGCCCAGAGCTGG - Exonic
1181381499 22:22508381-22508403 GCCCGGGCCCAGCCCGGGGGTGG + Intronic
1181461581 22:23089052-23089074 GCCCAAGCTCAGCATGGGGCAGG + Intronic
1182067039 22:27438254-27438276 GGCCATGCCCAGCCCCTAGCTGG - Intergenic
1182079322 22:27518054-27518076 CCCCATGCCCAGCCCACAGCAGG + Intergenic
1182335335 22:29580313-29580335 GCCCTAGCTCAGCCCAGAGCAGG + Intronic
1182422631 22:30256040-30256062 GCCCCAGGCCAGCCTGCAGCCGG + Intergenic
1183201486 22:36388029-36388051 GACCATTCCCAGCCGGGAGCCGG + Intergenic
1183702510 22:39458016-39458038 GCCCAAGCGCAGTCGGGGGCTGG + Intronic
1184111991 22:42401000-42401022 GCCCAGGCCCAGCGCGTAGGAGG - Intronic
1184336136 22:43854381-43854403 CGCCAAGCCCAGCCCGAAGCAGG + Intronic
1184465744 22:44668361-44668383 CCCCAAGCCCCGACCTGAGCGGG - Intergenic
1185235918 22:49712837-49712859 CCCAGAGCCCAGCCTGGAGCTGG - Intergenic
950686152 3:14619922-14619944 GGCCAAGCCCAGCATGGAGTGGG - Intergenic
951983987 3:28597660-28597682 GTCCAAGCCCATCTCGCAGCTGG - Intergenic
953385381 3:42503017-42503039 CTCCCAGCGCAGCCCGGAGCAGG + Intronic
954179499 3:48870626-48870648 GCCCTAGCCCACCACGTAGCTGG + Intronic
954373547 3:50182840-50182862 CCCCAAGCCCTGGCTGGAGCAGG - Intronic
954693172 3:52406631-52406653 CCCCCAGCCCACCCAGGAGCAGG + Intronic
955015346 3:55064382-55064404 GCCCAGGCCCAGCCAGGTGCCGG + Intronic
955341819 3:58130798-58130820 GCCTGAGCCCAGCCCGGGGCCGG - Exonic
955387183 3:58489144-58489166 AACCAAGCCCAGCACGGTGCTGG - Intergenic
956392174 3:68785445-68785467 TCCCAAGCCCTGCCCCGCGCGGG + Intronic
956867449 3:73384000-73384022 CCCCACGCCCAGCCAGAAGCTGG - Exonic
959014367 3:101116284-101116306 GCCCATGCCCAGCCTGAAGAAGG + Intergenic
959575178 3:107926118-107926140 GCCCAGGCCCATCCTGGACCCGG + Intergenic
960844340 3:121993112-121993134 GCCCATGCCCAACCCTCAGCAGG + Intronic
960949950 3:122992879-122992901 GCCAAAGCCCAGGCAGCAGCTGG + Intronic
960974155 3:123159202-123159224 CCCCATGCCCAGCCCGGGCCAGG - Intronic
961206710 3:125088218-125088240 GCCCAAGCCCAGCCAGGAATGGG + Intronic
961322249 3:126084059-126084081 GCCCCAACCCCGCCCGGAACAGG + Intronic
961677430 3:128576239-128576261 GCCTCGGCCCAGCACGGAGCGGG - Intergenic
962736358 3:138329256-138329278 CCCCGAGCCCAACCCAGAGCTGG + Intronic
966448194 3:180027231-180027253 GCCCAAGTCAAGCCCTGAACAGG - Intronic
968341599 3:197960283-197960305 GCTCAGGCCCGGGCCGGAGCCGG + Exonic
968405467 4:336648-336670 GCCCGAGCCCCACCCGGACCCGG - Intergenic
968674618 4:1871016-1871038 GCCCAATCACCGTCCGGAGCCGG - Intergenic
969316304 4:6383250-6383272 GGCCAAGCCCAGCCTCCAGCAGG + Intronic
969413097 4:7042592-7042614 GCCCAGCCGGAGCCCGGAGCCGG - Exonic
969620562 4:8276798-8276820 GCCAAGGGCCAGCACGGAGCAGG + Intronic
969682126 4:8649249-8649271 CGCCAGGCCCAGCCTGGAGCAGG + Intergenic
972335739 4:38106085-38106107 GCCCCAGCCCAGTCCGCAGAGGG - Intronic
975034031 4:69658883-69658905 CCCCAGTACCAGCCCGGAGCTGG + Intergenic
977693765 4:99946241-99946263 CCCGAGCCCCAGCCCGGAGCCGG + Intronic
978999361 4:115199037-115199059 CCCCAATACCAGCCCAGAGCTGG - Intergenic
982758286 4:159250864-159250886 GGCCACGCCCAGCCCAGAGAGGG - Intronic
984905336 4:184621034-184621056 GCCCAAGCCCAGGCTGGACGTGG + Intergenic
985217680 4:187671539-187671561 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
985595049 5:784296-784318 GACCCTGCCCAGCCCGGGGCTGG - Intergenic
985636013 5:1036272-1036294 CCCCCAGCCCTGCTCGGAGCGGG + Exonic
985774315 5:1832881-1832903 GCCAAAGCCCAGCTCTGAGAAGG + Intergenic
985787883 5:1909259-1909281 GCCCACGCCCAACCAGGGGCAGG - Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
986402939 5:7396581-7396603 GCCGAGGGGCAGCCCGGAGCGGG - Intronic
986446493 5:7825772-7825794 GCCCAAGCCCAGGCAGGCGCGGG + Intronic
986804278 5:11293920-11293942 GAACCAGCCCAGCCCAGAGCTGG + Intronic
987321106 5:16770115-16770137 GCCTCAGCCAAGCCAGGAGCTGG - Intronic
987377095 5:17246117-17246139 GGCCAAGCCCATCCCACAGCTGG - Intronic
990003725 5:50922532-50922554 GCCCGGGCCGAGGCCGGAGCCGG - Intergenic
995841017 5:116443330-116443352 GCTCAAACCCAGCCTGGAGCAGG - Intergenic
997199905 5:132003587-132003609 GCCCCAGCCTGGCCAGGAGCCGG - Intronic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
998861417 5:146447580-146447602 GCCCTGGCCCAGCCCGGGCCCGG - Intronic
999245208 5:150150563-150150585 GCCCACCCCCAGCCTGGTGCAGG - Intronic
1001159566 5:169301048-169301070 TCCCCAGCCCAGCCCCAAGCCGG - Intronic
1001314011 5:170630011-170630033 CCCCAGGCCCAGCCTGGTGCAGG - Intronic
1001855378 5:175005737-175005759 GGCAATGTCCAGCCCGGAGCTGG + Intergenic
1002158535 5:177301666-177301688 ACCCAAGCCCAGAAAGGAGCTGG + Exonic
1002183322 5:177442527-177442549 GCCCAAGCCCAGCCCCTAGGAGG + Exonic
1002183714 5:177444236-177444258 ACCAAAGCCCAGCCCTGGGCAGG + Intergenic
1002840118 6:898220-898242 GGCAAAGCCCAGCCTGGGGCTGG - Intergenic
1002853760 6:1020185-1020207 CCCTAAGGCCAGCCCGGTGCTGG - Intergenic
1005048827 6:21665785-21665807 GCCCCGGCCGAACCCGGAGCTGG + Intergenic
1006418308 6:33918392-33918414 GCCCAAGGCCTGGCCGGGGCTGG - Intergenic
1006852233 6:37107199-37107221 GCCAAAGACCAGCTCTGAGCTGG - Intergenic
1007614070 6:43170456-43170478 CCCCAAGTCCAGCCTGCAGCTGG + Intergenic
1007680534 6:43630089-43630111 GCCCTAGCCCCGCCCGAAGTAGG - Intronic
1007696659 6:43737963-43737985 TCCCAAGCCCAGCCCTCAGTGGG - Intergenic
1009192873 6:60650700-60650722 GCCCCAGCCCAGCCCTGGCCTGG + Intergenic
1014943900 6:127475160-127475182 GCCCCAGCGCGGCCCTGAGCGGG + Intronic
1015924002 6:138291871-138291893 CCCCGAGCACAGCCCGGAGCAGG + Exonic
1016820662 6:148343127-148343149 GCCCGAGCCCGCGCCGGAGCCGG + Exonic
1017717499 6:157222887-157222909 GCCTTTGCCCAGCTCGGAGCTGG + Intergenic
1017717507 6:157222895-157222917 GCCCCACCCCAGCTCCGAGCTGG - Intergenic
1017891608 6:158644283-158644305 CCCCAGCCCCAGCCTGGAGCGGG - Intronic
1018021087 6:159762522-159762544 GCCCGACCCCAGCCCAAAGCCGG - Intronic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1018917954 6:168149186-168149208 GCCCCAGCCCCACCCGGACCTGG + Intergenic
1019281618 7:203178-203200 GCCCAACCCCAGCCTGGGGAGGG - Intronic
1019570323 7:1708431-1708453 GCCCAAGCGCAGCTCTGTGCTGG - Intronic
1019594266 7:1851176-1851198 ACCCATGCCCAGACCAGAGCGGG + Intronic
1019594289 7:1851245-1851267 ACCCACGCCCAGACCAGAGCCGG + Intronic
1020111464 7:5450529-5450551 GCCCAGGCCTTGCCCAGAGCAGG - Intronic
1020230928 7:6317962-6317984 GGCCAAGTCCAGCCTGGAGCTGG + Intergenic
1020713330 7:11636596-11636618 GCCCAAGCCTCTCCTGGAGCAGG - Exonic
1022089666 7:27099146-27099168 CCCCAAGCTCAGCGCGGAGCAGG - Intergenic
1022093458 7:27123351-27123373 GCGCAAGGCCAGGCAGGAGCAGG - Intronic
1023684653 7:42721883-42721905 GCCCCAGCCCAGCCCCGGCCAGG + Intergenic
1025235067 7:57228793-57228815 TCCCAAGCCCACCTGGGAGCAGG - Intergenic
1025261729 7:57424824-57424846 GCCCCAGCCCGGCCCGGCCCGGG + Intergenic
1025787507 7:64657218-64657240 GCCTAGGCCCAGCCTGGAGACGG + Intergenic
1026176054 7:67998010-67998032 GCCCAGGTTCAGCCCAGAGCTGG + Intergenic
1026592756 7:71711047-71711069 CCACAAGCCCAGCCCGGGGCAGG - Intronic
1026802929 7:73411157-73411179 GCCCAAGCCCAGGCTGGCACTGG + Intergenic
1026837176 7:73647119-73647141 TCCCAAACCCAGCCCAGAGGTGG + Intergenic
1026837485 7:73648173-73648195 CCCCGAGCCCAGCCCGCGGCTGG - Intergenic
1026979548 7:74518336-74518358 GCCCCAGCCCAGCCCCGGGCCGG - Intronic
1027405322 7:77854568-77854590 CCCCAACCCCAGCCCAGGGCAGG + Intronic
1029640264 7:101815924-101815946 GCCAAAACCCGGCCTGGAGCCGG - Intronic
1029690015 7:102175141-102175163 GGCCATGCCCAGCCGGGCGCAGG + Intronic
1029849229 7:103445642-103445664 GGGCAAGCCCAGCCCGGCACAGG + Intronic
1030063791 7:105643550-105643572 CCCCCAGCCCGGCCCGGATCGGG + Intronic
1032084126 7:128874681-128874703 GCCAAAGTGCAGCCCTGAGCTGG + Intronic
1032097920 7:128948744-128948766 GCCCAGGCCCCTCCTGGAGCAGG + Exonic
1033040982 7:137917996-137918018 GCCCCAGCTCAGCCCAGAGATGG + Intronic
1034400856 7:150860645-150860667 TCCCCAGCCCTGCCCGGTGCTGG + Intronic
1034921541 7:155087498-155087520 GCCCATGAGCAGCCCAGAGCAGG - Intergenic
1035261668 7:157665495-157665517 GCCCATGCCCAGCCCTCAGTGGG - Intronic
1037547320 8:19937176-19937198 TCCCAGGGCCAGCGCGGAGCAGG - Intronic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1041051566 8:53939645-53939667 GCCCCAGGCCAGCCCGGAGCGGG + Exonic
1041227835 8:55717540-55717562 CCCCAATACCAGCCCGGACCAGG + Intronic
1041942796 8:63407414-63407436 GCACAACTACAGCCCGGAGCTGG - Intergenic
1045317076 8:101052455-101052477 GCCCAAACCCAGCCATAAGCAGG - Intergenic
1046902285 8:119536312-119536334 GCCTAAGCCAAGCCTGTAGCTGG - Intergenic
1047064912 8:121270495-121270517 GTCCAATCCCAGCAAGGAGCTGG + Intergenic
1047130693 8:122017070-122017092 CCCCAGTACCAGCCCGGAGCCGG - Intergenic
1048398020 8:134033407-134033429 TCCCACGCTCAGCCCAGAGCTGG + Intergenic
1049202725 8:141349825-141349847 GCCACAGCCCAACCCAGAGCAGG - Intergenic
1049212254 8:141392171-141392193 CCCGAAGCCGTGCCCGGAGCGGG - Intronic
1049245900 8:141562379-141562401 CTCCAAGCCCAGGCTGGAGCAGG + Intergenic
1049536763 8:143186127-143186149 CCCGACGCCCAGGCCGGAGCCGG - Intergenic
1049761520 8:144333949-144333971 GCCCACCCCGCGCCCGGAGCTGG - Exonic
1049765698 8:144354358-144354380 GCCCCGGCCCTGCCCGCAGCCGG + Intronic
1050598079 9:7224078-7224100 GCCCCAGCCTGGCCCGGAACAGG + Intergenic
1052019968 9:23514433-23514455 GCCTAAGCCCAGCTCAGAGTAGG + Intergenic
1053424853 9:38004048-38004070 TCCAAAGCCCAGGCAGGAGCAGG - Intronic
1053489721 9:38489315-38489337 AGCCAGGCCCAGCCCGCAGCAGG + Intergenic
1057138763 9:92714174-92714196 TCCAGAGCCCAGCCCGGTGCTGG - Exonic
1057804563 9:98211036-98211058 GCCCAGGCCCAGGTTGGAGCTGG + Intronic
1057833702 9:98427273-98427295 CCCCAAGCCCAGGCCAGAGGTGG - Intronic
1058156664 9:101524035-101524057 CCCCAGTACCAGCCCGGAGCTGG - Intronic
1059352257 9:113673726-113673748 CCCCAAGCCCAGCCCACGGCAGG - Intergenic
1060506547 9:124202285-124202307 TCCCAAGGCCAGCCCTTAGCTGG - Intergenic
1060529843 9:124341690-124341712 GCCCCAACCCACCCAGGAGCTGG - Intronic
1060589978 9:124810510-124810532 GCCCAGTCCCAGCCCTGGGCTGG - Exonic
1060785785 9:126450841-126450863 CCCAAAACCCAGCCCTGAGCAGG - Intronic
1061067688 9:128288845-128288867 GCCCAAGCCCAATCAGGAGGAGG + Exonic
1061119099 9:128632342-128632364 GGCCAGGCTCAGCCCAGAGCAGG + Intronic
1061188591 9:129069322-129069344 CCCCAGGCCCAGCACAGAGCAGG + Intronic
1061610310 9:131741108-131741130 GGCCAACCCCAGCCCGGGACAGG - Intergenic
1061695172 9:132368003-132368025 GACCAAGCCCAGGCCGGGTCTGG + Intergenic
1061871238 9:133521909-133521931 GCCCTTGCCCTGCCAGGAGCAGG + Intronic
1061886506 9:133593712-133593734 TGCCAAGCACAGCCCGGTGCTGG + Intergenic
1062044699 9:134419609-134419631 GCCCAGGCCCTGCCCCGCGCTGG - Intronic
1062729705 9:138102070-138102092 GCCCGAGGCCAGCCCAGGGCAGG - Intronic
1185666860 X:1772445-1772467 CACCATGCCCAGCCAGGAGCAGG - Intergenic
1188640931 X:32503799-32503821 GCCCCACCCCAGCACTGAGCTGG - Intronic
1188862758 X:35276299-35276321 TCCCAGGCCCAGCAGGGAGCGGG + Intergenic
1190258896 X:48785984-48786006 GCCCCAGGGCAGGCCGGAGCTGG + Intergenic
1190278219 X:48912791-48912813 GCCCAACCCCAGCCCCGCCCTGG + Intergenic
1192145621 X:68680360-68680382 ACACAAGCCCAGCCTGGAGCTGG - Intronic
1192340494 X:70259675-70259697 GCCCACCCCCATCCCTGAGCTGG + Exonic
1193253334 X:79319108-79319130 CCCCAGTACCAGCCCGGAGCTGG - Intergenic
1193468873 X:81876007-81876029 GCCCTAGCCCAGCAAGGACCTGG - Intergenic
1195338765 X:103883843-103883865 GCCAAAGCCTAACCCAGAGCAGG + Intergenic
1195675886 X:107506980-107507002 GCCCAGCCCCGGCCCGGAGGGGG + Intergenic