ID: 1039454522

View in Genome Browser
Species Human (GRCh38)
Location 8:37698096-37698118
Sequence TGCAGCGCGCACGACCCTGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 56}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039454518_1039454522 2 Left 1039454518 8:37698071-37698093 CCTCGGCGGCTCCAGCTGCTCCA 0: 1
1: 0
2: 2
3: 25
4: 309
Right 1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1039454515_1039454522 17 Left 1039454515 8:37698056-37698078 CCACGGCGCCTCGCACCTCGGCG 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1039454517_1039454522 9 Left 1039454517 8:37698064-37698086 CCTCGCACCTCGGCGGCTCCAGC 0: 1
1: 0
2: 1
3: 20
4: 264
Right 1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG 0: 1
1: 0
2: 1
3: 2
4: 56
1039454519_1039454522 -9 Left 1039454519 8:37698082-37698104 CCAGCTGCTCCACCTGCAGCGCG 0: 1
1: 0
2: 2
3: 39
4: 311
Right 1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG 0: 1
1: 0
2: 1
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039454522 Original CRISPR TGCAGCGCGCACGACCCTGC CGG Exonic
900658586 1:3772240-3772262 TGCAGCGCCGACGAGACTGCGGG - Intergenic
902369103 1:15994211-15994233 TGCAGTGAGCATGACCATGCAGG + Intergenic
904425474 1:30419972-30419994 TGCAGCCCACACTACACTGCAGG - Intergenic
904585435 1:31577214-31577236 CCCGGCGCCCACGACCCTGCTGG - Exonic
915547462 1:156609212-156609234 TGCAGCGCCCAGAACGCTGCAGG + Intergenic
917797534 1:178542751-178542773 TGCAGCGCGCGGGGCCCGGCGGG - Intronic
919919904 1:202161548-202161570 TGCAGCGAGCATGAACCGGCTGG - Exonic
1076146474 10:128126243-128126265 TGCAGCGAACGCGACCCCGCGGG - Exonic
1077289144 11:1780845-1780867 TGCAGCCCTCAGGACCTTGCTGG + Intergenic
1079251770 11:18792162-18792184 TTCAGCGCGCACGGCCCTGCCGG - Intronic
1085391332 11:76183775-76183797 TGCAGCTCCCCCGAGCCTGCTGG + Intergenic
1090944905 11:131421045-131421067 TCCAGCACGCAGGCCCCTGCGGG + Intronic
1106601644 13:31192574-31192596 TGCAGTGCGGGCGACCCTCCAGG - Intergenic
1112402012 13:99086107-99086129 GGCAGAGCGGCCGACCCTGCTGG - Intronic
1112580734 13:100674703-100674725 CGCGGCGCGCTCGGCCCTGCAGG + Intronic
1112652749 13:101416454-101416476 GGCAGCGCGCTCGGCCCGGCTGG + Intronic
1113470021 13:110537768-110537790 TTCAGCTCCCAGGACCCTGCGGG + Intronic
1113797490 13:113066840-113066862 TGCGCCCCGCACGGCCCTGCCGG - Intronic
1113900405 13:113793781-113793803 TCCAGGGCGCACCACGCTGCTGG - Intronic
1124125729 15:26936916-26936938 TGCAGAGCGCACGATGGTGCAGG - Intronic
1127583882 15:60363384-60363406 TGCAACTCCCAGGACCCTGCTGG + Intronic
1132568304 16:633197-633219 TGCACCGCGCGCAACGCTGCTGG + Exonic
1133248299 16:4463663-4463685 GGCATCGTGCACGACCTTGCGGG + Exonic
1133288855 16:4704699-4704721 AGCAGCGCACCCGACCCAGCTGG + Intronic
1133617181 16:7488187-7488209 TGCAGCGTGCTCATCCCTGCAGG + Intronic
1141842154 16:86579986-86580008 TGCGGTGCCCACGACCCCGCGGG - Exonic
1142752803 17:1998525-1998547 CCCAGCGCGCAGGTCCCTGCCGG + Intronic
1148754954 17:49968643-49968665 TGTGGCGCGCACGCCCCCGCGGG - Intergenic
1152750183 17:82059015-82059037 TGCAGGGGGCACCATCCTGCAGG + Intronic
1155176798 18:23307990-23308012 AGCAGTGCGCAGGACCCTGGGGG - Intronic
1158847975 18:61464593-61464615 TGCAGCAAGCTCTACCCTGCTGG - Intronic
1159507073 18:69352192-69352214 TGGAGGGTGCATGACCCTGCTGG - Intergenic
1161316438 19:3619674-3619696 TGCAACGCGTACCCCCCTGCAGG - Intronic
1161363136 19:3862874-3862896 TCCAGGGAGCACGACCCTGGAGG - Intronic
1165199743 19:34134282-34134304 TGAAGCGCGCACGACGCCGCAGG + Intergenic
1167158077 19:47751230-47751252 TTCAGGACGCACGACTCTGCTGG - Intronic
938875996 2:135531773-135531795 TGAAGCGCCGACGACCCGGCGGG - Intronic
944444812 2:199778554-199778576 TGCTGAGCTCACCACCCTGCTGG - Intronic
1179643181 21:42760429-42760451 TGCAGCGGGCAGGACCCACCTGG - Exonic
1183966843 22:41447241-41447263 TGCAGGGCGGACGACTCAGCGGG - Intergenic
1185095965 22:48806287-48806309 TCCAGGGCGCACCATCCTGCTGG + Intronic
1185171316 22:49296240-49296262 AGCAACGCGAAAGACCCTGCTGG - Intergenic
952967349 3:38629512-38629534 TGCAGCTGGCACCACCCTCCCGG + Intronic
955554954 3:60126908-60126930 GGAAGCGCGCACCTCCCTGCAGG - Intronic
969330780 4:6472480-6472502 CGCAGCGCGCACGGGCCGGCCGG - Intronic
976921506 4:90449543-90449565 GGCAGCTCACACGAGCCTGCAGG - Intronic
985783541 5:1882679-1882701 CCCAGCGCGCAGAACCCTGCAGG - Exonic
985808850 5:2068586-2068608 TGCAGCTGGGACCACCCTGCTGG + Intergenic
993095328 5:83473152-83473174 TACAGCGCCCACGCCTCTGCAGG - Intronic
1001639183 5:173233194-173233216 TGCAGCGCGCACAGCTCTGAGGG + Exonic
1018455324 6:163946576-163946598 TGCAAGGTGCACGGCCCTGCTGG + Intergenic
1022088808 7:27094656-27094678 TGCAGCGATCTCCACCCTGCGGG + Exonic
1035247849 7:157576573-157576595 CTCAGCGCGCACTGCCCTGCCGG + Intronic
1039454522 8:37698096-37698118 TGCAGCGCGCACGACCCTGCCGG + Exonic
1047397463 8:124514791-124514813 TCCAAAGCTCACGACCCTGCAGG - Intronic
1061631724 9:131876222-131876244 TGCAGCCCGCACAACCCTTCAGG + Intronic
1185547831 X:959800-959822 TGCAGCGCGGCCCAGCCTGCCGG + Intergenic
1185736635 X:2500889-2500911 TGCGGCGCGGGCGGCCCTGCGGG - Exonic
1189301578 X:39956240-39956262 TGCAGCCAGCATGAGCCTGCTGG - Intergenic
1195586072 X:106566784-106566806 TGTAGCCCCCAAGACCCTGCTGG + Intergenic